Description :
From Genome Similarity Track
Location :
Scaffold_87:7252- 8762
Sequence
1510 bases(100 bases per row)
gctggtggttacagcaccaagctatgggaccaaagggctccaaagtactccaacaacgtcatgatgagggtctgtttgttcctctttatcgttacgtttt
gtgaggaacttgccggctacggagtcaaccaatctctcaagaattttttccaaaaactcggatggtcgaacaaaggttccaactctatgaagctcacgta
cgggtgagtcaggttgcgtgtatcgctgctgctttcatcgccgacgcaagtacaagacgatcctcgtagcttcatccatcagctcaattggttttgtgct
gatcgcaatcgcagctgtgccgtcagtcctggataaccagttgctcaacaaggtgctgttttgcatcggagtgttcttgggtatcgcgctcaaccaagtc
ggtgtccgtgccctgctgattccgtttggcggtgaccagttctcccccacgtctccaccggagcagcgtgcttcatactttagctttaacttctgggcat
ccaatttgggtgctgtcttcccgtcgctgtgtttgtacggcatcggcgctattccagcagactatggctacgtgactgtctttgcaactggcttggcgct
gctgtctttctgaacatcatcgcggctttcatgtcggatgacggcgaaattggccacaacatctcgtatgtctgtgatgtcatggttgtagtgtggtcac
taccatcctgtggatttactttcggcaagacctgttgatggttgatggcgccactgacgacgatggtactgagttcgaccaggagctgaaacgtggagtg
aagcaagtctcccgttcaacgccttcaacatgttttggtgggtttgtcagaatcaacgacacaccgatgagcggcttggtagctcccccgattcaacgcg
aattccagccccgaccgtccagttttttaatccaggacctgggcacttgcttgtgtcgttcttcctcaacttagtctatccgatctacgataaggttgtt
ggtaagccacccagccgatacggaatggtagcagccggctacatcgtggcaatcgttgcgatgatctggacgagtgtttgaaattttccgacgcgatttc
ccgcttctcacatacgtggacgcaaacagtgagacgcagtacacctacaacatcaacggtgggtagccgatgagcgacattcattggtataatgcgattc
cccagtatatccttgtggctgcctcatccagattccgtccgacgcacaagattgcgtataccgaaatcccgatggctctccgtgcagtttctgtcgcgtt
ggaactcttcatgaactcaaggggcagcactctgctgtctatgattgtgctgttgtttggtaaggacattcctgcgaacctgaacgacggtcacatggaa
aacatgtacttcacgatcgttgggataattgctgtaaacgctatcttctaccttatcgtcatgaacaagatgcagtttgccatgatccccagacacggaa
aggaaccaac