Description :
From Genome Similarity Track
Location :
Scaffold_1207:725- 2445
Transcript NameFunction/comments
Phyag_g9892hypothetical protein

Sequence
1720 bases(100 bases per row)
GTCACCTGGAATTACCTGCTCGTATTGATCAATTCCAAGTCGCCGCATGGCTCGAGCGTATCCGTTCGTTAGTGTGAATACTGCGAAAGCAATCATTGCG
AGTGGTGCGTAGACAGCAAAACCCCTCCCGAATACATGCACTACACGAGTATTCGCTAACATGACATTGAACGCCGTGCCTTCCCCAAGACCCCCACCAC
GAAGCAGTAACAGTGCGTTCTGTCCCAACGCAAATTGTAGGCGACACTGATGGATGGAAGTCTTCAGTAGACATAGCTCAGTCGAATTACCATGAGCCCG
AAGCGCATACTTCCCGGGCAATCGAAGCGTGAAGAGACTCGTATAGCAGCATAGCGCCAAATACACAAGCACCAGCGCTGATATGAGTTCGGTAGCACTT
TGTAGATTACTGCCAGTCTTCTTTGCCTCCGCAGTGATGAGGAAGCGAAACAAGGATAACGAAGATCCATGCCAACCCATGGTGAGTTCACCCCACATCA
CACAAAGCGACAGAAATCCAGTCACAACCGCGCAAGTGATCGCCACTGGAGACGTGACCCAGCGCCGAATTTGGTGACGCGTGTTTAGGAAAAAGTTGTG
CAACCGGTTTAGCGCAGACGTTTCCGGATACAAACTGCCCGCTGGAAGTGCGCGCTGGGCATTGCGATCGTGTAGCACATCCACGTTGATGCAGAGCTCC
AAAAATGCTTGATCACATCGGCGTATTTCCAGTTGTGCCATTCGTACTCGACGATGCAGCTCAACAGTTTCCGGTAGTGTAGGAGCTTTATGAAGTGCTC
TGCCAACACTACTGAGTCCACGCTTTATTTTGCTCGATATGTCAGTACATGAGCCCGATTTATTCGTTCGTTTGGTATCGCCAGAAGCTTCAAGGCTGCT
GAAAGCTGGTTtattcttctccaccagtgTCAACACCTGTACCAGACATATTTTTACATACTGCATCTCGCTTGTAAGGACGATAGAGTCACTCTCAGCT
TGCATCATGCGTTGATACGCGTcacggacagcagcgaccacGTCGTCATATTCAAAGCGAGCTTCCATCCGCTCATTTTGCAGTTGTACCGCTTGGAAAT
GCCACTTTTGGAGTTGCACACCATCCAGCCGTCGCATCCAAAAACCCCTAGGGATCTCCACAAGTCCGTAACCCAGCAGCGCGATAACCCACAACAACCC
GTACGTGTTACTAGCTGCCATAGCGAGTCCCAACACCCCATACACCGACAAATGATCCACAAACACTAAGTACAGCGCCACGATAAACAATCCACCAGCG
ACTACACTCCAGTGGAAGACAAGGCGGCTTAGGGAACTCAAGATacgcttctccagctcgaacTCGCCGTTCTGACGGAATTCCACGAGGAATGGCAACC
CCACCCAACTCATGATGAACGTGAGCCAGTACAACAATCTCCAACTTCCCAAATACTCTCTAAACGTAGCTTTGTCCTCTGCAATACTACTGATAATCAG
AGATCTTGCAACGAGGCCATTCACAGCCAAATCCAttggaagaagcagcagacccaAGAATCCCAGCACCCAACTCATGAAGACAGCGGCATGTACAACG
GTGGGTACTTTGGCATCTTTGTAATGCGCCAATAGCCACCACGTGAAGCCCAGAAGCCCACACACCGCCAGAAGCGTCGCTAGCAGCGCCATGCTGAGGC
TTGTGTGTCAAGTTCGTGGA