Description :
From Genome Similarity Track
Location :
Scaffold_1281:725- 2272
Transcript NameFunction/comments
Phypl_g12988hypothetical protein
Phypl_g12989hypothetical protein PHYSODRAFT_518156

Sequence
1547 bases(100 bases per row)
ACCATTGCTCGTTTTGGTGTCGCCAAAACCACCACCAACCTTTCCGACTGCGCTCCCTCTCCTTTCAGAATGATCCGCAGCGCTTTCTTCACgatggagg
acgccaagatcgCATTCAacctcttctgctgcttctacGGTGTCGGGACGCTCGGCATGCCTGGCAACTTCTCTCGAGCTGGACGGGCGATCGCCATCGT
GGCTCTGCTCTTCACGGCTTTTGCCAACGTGTACGCGTCGGTGGCGATATCCAATgtgatgctgctggcacCAAGGGCTGTGCGTACGTATGGTGATCTC
GGTGAGTGGTGCATGGGCAAAGGGGGTCGATACGTGGTCGTTACCTCGCAGATGGGCGTGTGCCTACTGAATTGGTGCCCTGCGTTttcctcgtgctggg
cggctcgctgctcgacggGGTCTTATCTGAGGCGTTTGATCAAAATGTCTGGATCGTGCTAATGGCACTCATGGTGCTCCCGGTTTCCTCATGGTGACAC
TTAAGATACTTaaggaaggagctggcgctgcctTTGCAGGTTGTGCGGGCACTATCATCGCGGATTGCATCGGTGTTGCAGTCGTCATCCACGGCATGCG
CGGCCACCCGAGCGTGCCTCCCCCCAGATCTCCTTTTCGCAAGTTACTAGCGCTTTCGGGAACTTTTCACTTGCGTACGGCGCTGGCATCGTTATCCCAt
ggctccagcgccagcacagTGACCCCACTCGCATGCCTCGTGTTGTCGGTGTCACCATGATCTTCATTTCGGTGCTTTTCCTGGCACTTGCTAGCAGCGG
GTACTCCGCCATGGGGTGCCAAATCTCAGGCAACCTGCTGTTCACAATTTACCCGGACGCTGCCACGGGACTCACCTCGCTGGGTTTTGCGTCGAACTGG
GGTGCCGTTGTTTTggacatgcagcagcacgtcacGATTGCATTTGCCGTGGGAGTCTCACCGGCGTTTTACATCGCCGAACGCCTTGTGCTAGGCATGC
ACGAGCGGAACTCTCTGCAGCACGTACCCAGGGATGATGTGGAAGCAGCGACCAGCTATGACCCGACGGGGACTCCCATCATGAAGGGACTGCGCATCTC
GAAGCGTTCCATGGCGTCTGTGGTATCGATGGCGGATatcgagaacgacgacgcggaTGAAGAatctgaagctgctgagtACCGAGGCGCCAACTCGATC
AAGTACGCATTGCCATAGTTGCACTCCAGGTCCTTGCCTCGGTGCTGCTAAAGGACCACTTCTTGGACctgagcgacttcgtggGCTCATCCGCGATCAC
GATGAGTTGCATCATCCTGCCCATTGTTTTCTACCTGAAGCGCTGCTGGGATCAGTTCCTATCTACGAGAAGGTACTGGCACTTGTTGTGGTGGTCGTCT
GTTTTGTCTTGGGTTGCTACGTTACCTATCTGTCCGGCAAGGAGCTCTTTGCACCGTCCGAAAGCGAAATCAACTTTCCATTCTGCGCGCCCGAGTACAG
GAAGATGTCTATTTCAACTACACAGCCCAACACAAGGTGTAAGTTGG