Description :
From Genome Similarity Track
Location :
Scaffold_5:724930- 741087
Transcript NameFunction/comments
Phyci_89771Hypothetical protein
Phyci_89773Hypothetical protein
Phyci_300342Hypothetical protein
Phyci_1649Hypothetical protein
Phyci_187692Hypothetical protein
Phyci_137514Hypothetical protein
Phyci_136673conserved hypothetical protein
Phyci_133409Hypothetical protein

Sequence
16157 bases(100 bases per row)
TTGTCCAAGTGACGGAAGAGACCTTGAAACTCGCCAAGGTTTCCACCCAGATCCAACTTGTGATGCTTCTGGTTGTCAGCAGGCGAAAGGAACGAACACT
CTGCACCCAGCAAGCTCGCTCGCTTCTGAATCAAGGTACGCAGGTTGTCTGCCACCTTCTGTTGGTGCTCAACCACTATCTTCAGGCGAATATTCTCGCA
CTCGGTTTTCTCCCTGCGTCGGCGTTGACTGTCAGCGATGTTCTCCCACACGGTCGACATCGTCGGCGTGGCAGCAGCATTTGCGCTCAGCCTTTTATGC
TTCAAAGGAGCAACTCTTGTCTTTGAGCTAGTGTCTCCTCCCTTCTGGCTCTTGAGCACTTCCAGATCAATCTGTAATTTCTCAAGTTGCTCTCGGAGGT
GGACGATCTCGACCCGGCGGTTGCGACGCACTTTCTTCGAGCTGCCGTAGACACCAACAGATCGCATCCTCCTCCTCCTGTCGGGTTTCCGTTCCCATGC
CTTCACCACACCGTCCTTCCCACCCTCGATCATGTGCAATGAGATGCTGCTGTTTGTCGATACAGAACTCGGGGAGAAAGTTGCATCAGTGTCCGGGGTT
GTTGTTAAAGTGTCTTCATCAGGTCCAAATGTATCCAAGTAGGAAAGTGCAGCCTCCACGACGCTGTCATCGCCCTCATCCAAGAAAAACGCCATAGCAA
TGTAATCGTTGTCCCGACGAGTCTTGAAATGAGCACGGAAAGGATAGTGTTGAGAGGGTGTAGAGCGCGCGCTTGGAATGAATGCTGTGAATACCTAGTG
GTGATTAGTATTTGACCAAATGTCAGTTCGCATCCTGCCAGCGATCTGCTACTTGTTTAGAGTACCATCTCCCGACGCAACGCTTGATCAACCAAGGCAC
TTTCGATTCGATCTTGGTGGCCCTGTGTTTTCATTGCTGAGTTCACGATCAAGAAGTTGGTGAGCGTTCGGATGGTATCAGGGCCGTACAATGCTTCGGC
Ctcctggtcgaacgtgatgagagagcaacattggagttgggacagctctcgctgcggcgttgaagctggcgaccgctttaccttcgcgtagccacggaga
tgataggtaagcccccgcaaaattttgtgcctgatctcggcgggggctacttgagcaacccagattacgagatcgtgatcggcttctacatagcgccgta
cgacctgcttcaccttcacatctgcacgcgacttgttcgaatgcatttccttcgtaaaggcttcaatgacagtgtacgtctcgcccagatcctTTGCTGC
TTTTGAGTAGATGGATCCATTTCCCAAGTGCTTTTCGCTTGATTTGAAGTGGTTCCACGCAGCTTCAGTTGTGTCGCTCAGCTTGAACGGCAGCACCTTG
TTCGAAAACGCCTCGAGATATTTGCCCTCGTCTCCTTCGCGGATATGTACATCGCTCGGAGTGATCACCATCTTCTCGAGTCCGTTGGCCGCGAACACGA
TGTCTACCTCGCGACGAGCAGCTTCGAGCTGTCTAAACAGACCTTGAAAATCACCGATATCTCCGCAGAAGTCCACGACGTGGACGATCTGCTGTCTCGG
ACTGACATCGACAAAAGACGAGCACTCAGTCGCCTGCAACGAAAAACAACAGACAACAGACAAGGGTCAGATCACGTCGACAGTAGCGTAAGCGTAGGAA
AAGGTCCTCACCAACTGCCTCGCTCGCTTCTGGAGCGTGCTACTCAAGTTATCCGCTACTTTCTGCTGGCGTGCTGCAATCATCTTCAAGCGGACATTCT
CACGCTCAGCCTCCTCCCGTCGCTGTCGTTGCTTTCTCGCCACCACCTGCCATAAACCTGGAACCTGCGGTATCGAGTTCATCGCCACCTGTGGCTGCAG
AGCCCGCTGTCGGGGCCTCCTAGAGCGAGTCTGCAAATTCTGCAGGTCGATCTGCAGCTTCTCCATTTCCTCTCGGAGGTGGGCGATCTCGCGCCTCCTT
TCGTTCCGAGCTCGGTTGGGGTCGCTGTAGACGCCGGTCTTGCGCAGAATTCTCTTCTTGGCATTAACCACCGCACGTCTTGTCAGTTCGCTTGCATTCG
CAGCCGAAAGCGGCTGTGGTGCAGCAACTTTCGTCCTAGACGACACCGAGTCAAGCTCGAACTTATCCACGAAGGACAGCGCCGCCTCGAGCACGCGGCC
GTCGTCTTCGTCGTCCAGGAAGAACGCCATGCCCCTCGGCGTAGTCAGTTGTCGCAATGTGCGCCCCAGCTCTGCAAAGCACCAAGCGATTGGCACAACC
GCCGGCATGACGAACTCCGAAGGATTGTGCACCTGTCATTTGGTCACTGCGCAGAACGCAAGCGTCCGGCCTCAGATGAAGTCGACGCGGTTCGCCACCT
TCCAGGGGAATGGCGTTGCCTCGCTGCAGTTCGTCGCTCGACGCTGCAGATACTACGCGTTCATCAACACGTTCATCTGCGGCGTGGCCATGAGCAGTTA
CCTGGTCGTGTCGTGGGCGCAAGGCTTTGACGAGTCTTCAGCGACGTTCGCGGCGGTCTACGGGGCGAATTGGCTGCGCATTCTGGCGATGATCAAGTGG
TTCGAGTGGATCGCGACCAAAAAGCAGCAGATCAACGGAGACAAACGCGTACAGCTCACGGGCAAGCAGAGCAGAAGCATCTACCGCCGCATCCTGTGGC
TTGTGGTTCCCACCGAGTGCGTCTCTTTCTGGTTCGCACAGCAGACCGCTGCAGCTGTGGAAGGCAGCGTGGACTGGTGGTACTTTGTTGAGTACGCCTG
GTTCATCCCCAAGTCGTTGCTGTTCGAGGTCGTGTTCGACTTCTTCCACTTCACCATGCACTGGGTCTGCCACTACTCCACCTGGCTCTACAAGAACGTG
CACAAGCGCCACCACCTGCACCTGCACCCGTGCCCGTTGTCGACGTACGAGCAAGATGGAGTTGACCTCTGTCTCACTAATGTGTTGCCATTTTATTTGG
CGTGGGGTTTGAGTTTTCCGTTCTCGGATTTTCAATTGCATCTGCTGTTCGCTTACAAGACGTATGTGGAGGTGGCGGGACACTCCGGCTTGGAGATCAA
AGGCTTCTCGTTCCCGCAAATGCCGCTGGTCAATAATTTCACGAGCATTTGTCTGCGAGTGCATGATCACGATCTCCATCACACGCATCCGCGCTGGAAC
TTTGCCAAACGGTTTTCACTTTGGGACAAGCTCTTTCGGACATTCCGCCCCGGTAAACTTCTCACAGAAAAAACTTCCTGACTCGTTTTAGTACTGTGGT
CTACCTTGCAAGTGCAGCAATCACTCAAAACCTGTTCGTATTGCACAGCGTGATGCTTATCTTCGGAGTAATTCCTAGTCTTGCTAGCCCTAGTATTAGT
CAATGTTTTGAAGACTGCAGTACCAGCTATTATGCCCAAAACAGTGTTTGTATACACCTTAAAGGAGCGTTACGTGTGGATGCGTTTTGGAGTATTTGAC
TACATGTACATGAAAGAGAATTGTTGATGAAGCATAGAACAACATCCTACTTCGTGTTTGGGTCGTAAAACCGCGCACCGAAAAACCAAAGACTTGAGAT
AGTTCTAACAAAGCCATACTTCCCCTGGGACAGATTGCGTGGACGTACAAGTAGGTGCGACGTTGATCCGACCATGTGTACAATGCCAGCAAAGAGCACG
CGTGCTATCTGGACGAATTAGGACCAATTCGCCACAAAGTAGAATAAAAGCGTATTCAACGATAAAAGTATCTAACGATAAAAAAGCGTACCTGAAACTT
TTGTCAGTTTACTCCGCAGAGCGTGGTCGATAAGTCGGTTCTCGATGCCGCTCTGGTGGACGCGCATGTTTTGCGCCGTGTTGACGATGAGGAAGTTGGT
GAGAGCTCGCATGTTGTCGACGCCGTACATTGCCTCGATGtcctggtccagcgagatgaggtagcagaactgcagttgggacagttcctggcctggtgtc
gatgctgcggaccgcttcgtgagcgcgtagcctcgcaggtgatatgtcaagcctttgagcatcttgtgcttgatctccgtcggcgctacgctcgccaccc
aaatgacgatgtcgcggcccggctcgacaaagcgccgcaccacttgcttcatcttcacgtctgctcgagagctgttcgaaaacacctccttggtgaactc
ctcaatgaccgtgtacggctcgtccagatccCTCTTCGCTTTTGAGTAAAGGGATCCATTGCCTAGGTGCTTGTCGGTTCCTTTGAAGTGGTTCCATGCA
GCCTCGGTCGCGTCTCGCAGTCTGAAAGGGAGAACTTTGTTTGAGAACACCTCGAGGTACTTACCACCAACACCTTGGCGGATATGGACATCACTGGGGG
TGATCACCATGCTTGATAGACCGTTCGCGGCAAACACAGCGTCGATATCGCGGTATGCCGCTTCGAGGTGTCGGAAGAGGCCTTGGAAGGAGCTGATGTC
GCCATGATAGTCGAGTACGTGAACAATTTGGTGCTTTGGACAGTTTAGACTCGAGAAGCACGAACAATCGTTTTCCTACATGAAAACCACGTTAGTCAAT
ACAGCGATTCTTCTGTCGTAACGAGCAAAATATACTTACAAGTTGGCTTGCACGCTTCTGCAGTAAGCTGCTCAGGGTGTTGGCAACCTTCCGCTGGCGC
TCCATGACAAGTTTTAAGCGGATATTCTCTCGTTCAGCTTCTTTGCGGCGGCGTTGTTGGCGATCTGCTATCTCCTGCCAGACGCTCGATATGGGCGATA
TCGAGTTCGTCATCGCCACGACCAGTGTGTTTGTAGGCAGGTACTGCACTTCGAGCTGCTGCGTCAGTCTCGGTGGTTTTGGCTGTCCGTCCTTGTGCGT
TTGCAAGGTCTTCAAGTCGATTTGCAGCTTTTCGATTCTGTCGCGCAGGTAGGCGATCTCCAGCTTGCGTTCGTTCCGGACGCGGTTCGAGTCGCCATAG
ATACCAGCTTTACGCAGCAGCTTCTTCCTCGCATTCCTCGCAACAATCTTCTCCCTTCGAGTCATCCCGGTCGTGTCCAAGCTAAGGATCGACGGAACTT
TGCTCAAAGCCGTCGATGTCGCCGCATGGCCGTCGTGGACCCTGAGTAACTCCACTACATCAATCGCACCATTAGGAGCTGGGTTGGGATCCGCGTGAGC
TGGCGCCTCTGACGCAGAGGCCTTTGCCGCTAGCGCAGCTTCTGGCTCGGGTTCATCAAACGGGAACTCGTCGATGAAGGACATGGTCGCCTCGAACACT
TTGTCGTCGTCGTCTCCCTGGAGTAGCGCCATGCTGCCTCTAAATCCCCGCCAACCTGTCAATGGGCCCAAGGGGCGAAGCCACAAGTTGTCGGCGACAA
AGGCATGTTCCAGCCAAATGGCTCGTGAGACGAAGATGAAGATGATGTGATAACAGGATTTGCTGGGCTCAACTCGAAGCAGAAAATGATGTTCGTCTAC
TGTAGTGTCATTACATGTGCTCCTGTAGTGCTCGATCTACTAACGCGCTCTCAATGCGATCCTGGTGGTTGCGAATGTTTTGAACTGTGTTGGCAATCAA
GAAGTTGATGAGGACGCGCGCGTTGGCAGGGTCGTACCTGGTGCCAGGTtcttggtcgagcgagatcaacgagcagaattgcaactgcgatagctcgcgc
cctggtgtcgacgccggcgagcgctttgtcagcgcgtaaccccggagatgatacgctaaccctcgaagcattttgtgcttaatttctgtcggcgacacgt
gcgacatccaaatcacgacgtcgcggtcgcgctcgacgtagcggcgcacgacttgcttcaccttgatgtcagcacgagaattgttggaatacaattcctt
tgtaaagtcctcaatgatcgtgtagggctcgttgaggttctACTTGTTCAGCCAGCGCAAAAACAACAATAAGAATATGTTAGAGACTATCGTTTGCTCT
CGCTGTGGCAACCCACCTTCGCCGATTTCGTGTAGACCGAGCCGTTACACGCATGCTTCTTGATTCCTTTGAAGTGATCCCATGCTGCCTCCTTTGCATC
GCTCAGTTTAAAAGGCAGGATCTTGTTAGCGAACAACTCCAGGTACTTCCCGCCGACGCCTTCGCGAATGTGTACGTCACTCGGAGACACCACCATGTCG
GCCAGACCATTATCCGCGAAAATAGCGTCGAGTTCTCGATGCGCAGCCTCGTTGAGTCGGAATAGCGCCTCAAAATCGGCAACGTCCCCACGGAAGTCCA
GTACGTGGACGACGTGAGGCTTGGGAGCGCTCGCGTCCATGAAGGACGAGCACTCGTTCGCCTTCATGACAACCACAAACAAGCAAATGAAAGGTTAGCA
TTTCGCTAAACCTCCTGAATACAGATTCAATGTCTTACCAGTTGACTTGCCCGTTTCTTGATCAGCGCGCGGAGGTTGTCTGCCATCTTCTGGTGCCGAT
CCAGAATGAGCTTCAATCGAACGTTCTCTAGCTCCGAGCCTTCTCGACGCTTCCTCTGGCTGTTGGCAACAGCCTGCCACATGCTCGGAATCTGTACTGT
CATCTCTGTGCTCGAGCTCATCAGAGACGCGCTCGTCACTTTCGAGCGGTCCTTCTGACCCCGTAAAGCGTGAAGGTCGATCTGCAGTGTCTCGATCTGC
TCCTTGAGGTAGGCGATCTCTAGTCTGCGAGCGTTGCGTGCTCGGTTCGGGTCTCCGTAGACTCCAGTCTTGCGCAGCAGCTTCTTCCGTTCGTTGACCG
TACGGCGCTTGGTCGCTTCGTCCTCGGTTGACCTCAGCAGCAGCGGAGCCTTGCAACGAGGAGCACACAGCATCGACCTCGATAACTCTTCTCCAGTTAT
CACCGCCTCATTAGCCGGTGCGATAGCATTAGTGACGACGTTGGTCGGTCCTCGAGGTACCAACGCCACCTCGTTTCTGTGCAGCCCATGGGTCTTCACC
ACGGCTATTTGTGCAGCCGGCAGACCCTCACCGTCAAACGTGAACTCGTCGATGAAGGACAGCGCCGCCTCGAGAGCTTGGTCGTCATCGGGGTAAAGCG
CCATGGCTCCTCCCTTGGCCTCGGCAGCTCAGCAACGCTCCTCTTCCTCCTCGAATTCCTAAGACAGATGGCCAAGTGTGTGGGAGTCAGCGATTTGCCA
GGCTCGAGTTAGTTACCATCAGGTTGCGTCGATTCGAATGTCAGTTAAATATTCGGCAaagctcgcgtccagggattgagtagcaggtatttgccagtcc
ttgaaacaggtattatccaggtatgcaaattgaaataaatttccgaattttATTTTTTTCTTACCACcctccagccactcattcactcaaatcggcggga
gcggcacgtggcaaccatggcacgcacccacaagacggcgctgatcaagcagcgcatggctaatgaaactagagaggagcaggaagccagggaagcagag
gaagcacgcagagagagcataagggcggcacggacgaggtcggagaaggcacaagcgatgaagaaggctgctgaagagcggaatgctggtggaccaaatg
tgccgcggtctagtagcactagcaatgccagcgaagatgaagtgatgcaagacgaagatgggagtgctgaggctgacgaagaggaacgaggtgaggacga
cgaggaagaacgagcggaggatgacgaggaggatcgcaatgatgatgaatctgatgtggaggaaaggtcagacgaagcaaaagctgcagcagcaatcaca
tcccgtattaagaagaagcgcacgctgagtgatgtcgaagacgaagtcatggtgacagttcctgcattaggtgcaggacaacgcagctggcctcttttcg
aggatgccctcaaagattacatgaagaacaccagccaggttctcgtcgtcaaggagaatattaacgtcaaaagacgcgacaatgcactgcgtgcgcagca
gcagtaccaaggcaagtcagacgacgagattcctctcattccaactgagatgaagttataccagcgcaaatacacatgcacccatgggtggggcgagcgc
ctgagatgaagttataccagcgcaaatacacatgcacccatgggtggggcgagcgcgagcgatCTACcaccggtaaacgtaaggttcacaagttacgacg
ggctgattgcccctttcagtttctggcgcaagtgacgaagcaggatgacgaatcgtgagctattgaacttcgtcgagaggactacagacacaaccacgac
atcagcgagaatatctacaggtcttacccaggtattcgccaggtttcacacaattctccacttatgcccggcattgaattgctcatgcagtctaatgcaa
aaccttcaagcatctacgactacatcagagagaattcgtctcacagtgtcactatgaaggatgttcagaatttggtggcgcgtttacgtcgttctggtgc
gtggtgttagcagaggcggtcatgtatgttgagcatctaatgcggaataatgttggatacttgtaggtgatgaactttcagatgacgacgctgtcaccaa
aatgctagttgatttcaatttacaatccgccaagaatgtctccaccgctaatcagagtgccaaaggaaacacaggggttatatcgttcacaactgggcac
atgcgagcaatgtttaatagctttccagaggtgctgcaaatggattgtactcacaaaacgaacaggtgggcacagtaacatccttttgccaggtatttaa
caggttttaaccgagtattgtgcaggtacaactaccaactgctctcgattgtagcgatggatcaatttgggcatggtcagccggttcagtactcgttgct
cgagactacatcggattggcacatggcaaaagctctcgataattttaaacgtgcgagcgaacactggcggttcattcaaatcgttatcgtggacaaggat
atgcgggaagtggacatcattcgacgcaagtttcctgaagcctgtatttttctgtgtcactttcatgtcataaagtggctgcacgaggtggttcgaagtg
ggaagtatcaatcattttcaaaggacgtggtcgagcagttgaagcatgttataacaaacatgacttactcgacagccgttgatgtttacgaatttcatcg
ggacgaattNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGatggactagactgcgactgtgattttgcgaaaacaatgaagctaccttgccgtcacgcgatggtgtacaagaagtcaactggaagcgcattcttca
tcccattcaatacgatcgaaccaaggtacgcgcagattttgccaggtttttaccaggtattggtcaggtatcgagcaggttttcactcacatggcacgtt
ttcttttgtgtaggtggtttggccagagtcgcagtactatggatcgagtaagtgcattatcttcgccgcttcttaccaaagtttacaaagctgaaaatca
atctcatggaggacttaTGACTGAGCGCGAAAAATAccggcgcgctcagcaagcatttggccgtatgagcggggagctgtgccagctttccgacgcgatg
ttcaacacagcaatgtccaaatttgatgaatggtggcacaatgtcagacaaggcaacgtggagattacatcacccgtcgctgccaatgatagcaacgagc
acagtggcgaaagtgatggtcgtgtgctgagcgaaaacagcgctgctgcagaacccaagatcctccaggatgcagagagcaccggtaaaggagatgataa
aggtaatcagaacaatgaagattgtgatgactgttacgatgtgccgcctacgcaagttgcatccgacgatcgtattgaagaagccaaggttgctataaaa
ctgaatgtctgtgctcctgtggtggaccggcctcgcgttaaccgggttcaacgtcgaaacacggctcgctgcgctttgatagagtacaataaaggcatga
aatggagagccctccttcgagacaaggacgtctctgacattgtggcctgcctcgatgaaattactccttctctccaggaagcaCGTTCGTACTTAGCTAc
acatcatgtgtacctacacagcggagttcctgcctttacttgggaagtggattcagattttgtgcctgatactgtgcgttaccgcctccctgaggctaca
gtggatatggcactcacgcgacttgataaagaaatgcttgttttgaatggcggaaagccgctactgaacgaaattgtgatagatggagagagcaatgaag
ataatgtggtagtcgttttcgagaagataggcaaatttacacgtaatcaattgcaggccatgaaatatctgtggaatttgctgagtatatgcaacaacgg
aaacgaatgttgcatgtggctgaaagatagagtaaaagttctggtggacaatgacggtaatgtggacggcgtatccgaaatgctcctgaatgcatggcct
tacgattcagttcccggtgtgcaaatgctatactgcgaactatatcgttttcgcggtggaacatggctaaatgacaataccatattggcctatgcatccg
ttctcaaaaagcaatacaaaaacaacgcctgtgtgctcttgccacaagcctcgagcgacgaagaaaatgctgtttcgggagaaagtatattgcgcatcca
cgagtNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NcaatacctgcacaggtaatataaaccaaaattaccgcactgtttatgtgtaaattcgatacctggtttaaacctgtcgccagacctggaaaataCCCGA
AGTATATTTGACCTAACCCTTCGAAATACCTGGACGGCAGCTTCGTCCTTAAATATTCTTAGGAGATTCGAGGGCGAATACTTTCAATTAGTTTTTCTAC
ATGCTCTTTCCGCGTCTCAATATCACAGACCAATAGAGGGCAATTTGACGTGTTACGTTAGCGGGAGCGTATCTACCCTGCGACCCGGCCGTGAGGCTGG
GCTGAGCCCCCCGTGGATAGGGTGGTAGATTCGTCCCGCTACGTTAGCGTTgtcgttgcccctgatccgctgaccattctagccgcgacgcccgcgacgg
attgtttgcataagcgcgtgtagaacttgaaagtgtctgaagcccagcggccgtggaactggatcgtcagcgcgtctactccggcccggtacatattcgt
tgctccaccggttctcagggagtgggtgctgaatctggccgggtcctcaccgatggcgcgcgcagcgcgttgaacagcagttgctacctgagccgccgtc
acacagcttggccggccgtcctcgactgtgaatacggcggctggaatcgaagctgggagtccctcccttgctcggaggaggagtgcgccgagcaaagcac
ggggtgccctgagcgtgccagcatctgagttgtcgggatcccgccctggttcgtcttggagccgcgtaggcgaatgcacaccgctgaggccgcgctcggg
tccatcgtgggagttccggcatggtcgatggttgtgatgtcggctgccttgagtgagaaccatcggaacgacgtgcttgtgattgcgacaatctcggagc
gtcggagcagaaagaagaaggccagaaacaggacccccaaagcgcttggtctgcgggagcgtggagatcgaatgccatggcgcaatgctcgaggaagatg
atggatacgggcgccttctggcgtctagggggggggtcaaggcgacccacgcccttcaggagcatacgaacctgtgggtgGCCGACGGGGAAATCGAGCC
CAACAGCCACGAAGAAATGTCGAACGCCGCCCAGGGTTGTCTTCATTGTGGAGCTTCGCACGGAGCGATTGGTGCCCGGTCGGCCTtgggtgacgtcaag
gatgaactcagacaccagggcaaattctcttccacgggaacgtctagttgccatgggacgccgtgccgccgctcccattgcttccaccggtcgaataatc
gcgcgtactgcttgaacgaggatttggccacggagggctctcggagaaactgcgccggatgccgctgaggctggcgatggttgcaggcgacggtgtcagc
tcacagcaacggttgtgctgtcgaacagacgtgaatgggtggggctctcccaccagcggaaacccgcgtccgccgcgatgttctcggcaccggggatgtg
tgatgctgagatcggcagtccgtactgctgttccacaagctgatcagccgtatgaggatctggaacctggggttgcgcgatgccattttcgtttgccacg
cgaccgccgacgtgttgtcgaccgggaagtgtacgtgtatcgaccgggggaggttgctggcggctcgccacgacggggaccatgcttagattgcgaatgc
gcaggcgTgaactggaatgtgagggtgaggtggagggccgggacgagtgcgcacagcccccgtccgaagcgtccgtggctacgacgatgtcgggttcggg
gagtgcaccgaagtatttgaggggtactctgttcaaagtctggtcttggAGAATGTGCCGCCACCATAGGAGGTCGTCGCGCATGGCAGACGTGATGCTG
ACGCGCGAGGGTCGGTGGAGCTGGCGTTCACGAGTGCGCAGGGGTTGGAGAAATGCCTGGGCGGGTCggacgcaggtcgcgacgtggcgcagcgacccga
ggatggagcggaagttgctgcgcgagaggctggcagaacggaacgcttcctcggcgcgttgacgcgccttagctatcttggcgggtggtacagcgaccgc
gccggccactgtgtcgaaaatgagaccgagcacttgctggtgcgtgctccaaggggtgaacttcttttcgttgacggcagtaggtcccatgacggacgcc
atcgcgaagcgaaggaagcgttcaatgtctgcgcagcgggaccctgtgtctgccgccacgttcatgtggtcgtcgacccagtggtagctgaagaaaccgg
cgggatgcgaggggttgacgctgctgccgtggatgtacgcgacggctcctccgagaacaccgtaggtaccggctgacccgaatcatcggaaggcggcgga
catgtcgatcacgatggcgttgtcctcggggatgtgaccgcagacacgataaactgacttgctgtggatgcaggcggccacgtcgccagccataacttta
acttcgcacgaggggtcaccggacttgcaccggataatctcccgagcgatgctagagcagtgctcaaaggtggctcttggtacttcggctgggtcagtgc
actggatgactgactcgtcctcggggaatgaaagatcgtggatcgtccgccctgtgaagtgggggtccgcgtcccccttgtcgacgacaccaaatgggct
gatgacgatctcgggccatatcttgataatgtcggcgtcgaccacgaagcctctcagcaagtcctgttctttcctgatggttttgcacaggacgttaatc
cgggcgatgcggacgggtgattccgccggaagcggtcctggtggggtggcggccgtcgtagatggactcgcacacccttggaagcgatgcggacgaagtc
gtggagctgtgggtatccgcggcacggtgtccgcaggcgttcggggagaagtgccttgttgggacggtaatcggctggagtttggcagcgcaggagtttg
ataaacgctttgagcgtcgggcaggtgcggcggatgtatgccgacatcactacctggaagcgtttgttgagctcgtaagcgtcgggggcgctcggacttg
gTGTGGCTGGGAGTTCGGCACCGGCTTGGCGGAAGGCAGTCCCTATTGAGGATCGTCGGATGGCGCTCCAGAGCTGGGTGCGGCGGTCAGGGCTTGGAGG
CCTTCTTTGGACGGCGTGGGCAGCAGCAATGTGCTGCGCGGCATGGTTGTGACCGGGGCGACGACGCGGTTCCAGGGTATGTTGTGGGAAGATGCCGCTT
CAGCAGGGAATCCGTCGGTGGCACGCCCGGTGCTGGGGGCGTTGTGTCTTTCGCCGGTAAGTGTAGCACGTGATGTGATCATATCGTATCTCTCGGCGAT
ATGGCCCGTATGTGTAGGCTTCACGTCGGCAAGTGGACGATGCGAAGGAGAAAGGTTGCACCCATCGACGGCATGGCCCGCGGATGCGGGATTCTCGTCG
GCAAGTCCACCGAACATGATATGAAGTTCGCACCCCTCAACGGCATGACCCTCTGATGTGGTTTTCTCGCTGACAGGAACAAGAGACTGCGGGTGGCAAT
GTGTGTCGCGTGGCTTCCTGTCGCTGAACGCCGATGGCGTCGCGCCAGGATCTGCAGAGCTGGGGCGTGTATCAACAATGGCTTCGAGTTGTATGTCACC
GGTGAGTGATCGGGATGGTTGGTCCACTTGGTCTCAGATTCTTGTATGGATTGTGTGTATTCGGATTATGGCTGAGGTGAGTTGAACGAAGTGCAGGTGG
ACCTGCAGCACCTCGTCCCCCTCAAGCTCGTCGACGCTGGTTGAAGTCGCGGCGGCCGAATCACTTCTTGGTGTACGCGAGCAACGCGGCGGGAAGCTCG
TCGAGCCACGTGTGCAGGCGATTGCGTGCGGCACAGGTGGCTGTGGACCCACCATAGCACGTCGAGCCTGAGACGAAACGCAGGCATGGCTCCTGGCCTT
CGGCGTTGAAGGGTATCATCGCCATTGTGTGGGCTGGAAGGCCGCTTGGGTGGGAACTCCGGGGACCTGACTCGCGGGTGACGCGGCGGTGCGAGGCATG
TGTGACCGTAGTGGGACCGGCGGTGCTGGCGGTGGCGGCGCCGGGTGCCATCGTGGCGCACAGCGCGAGTGCCCACAACGTCGAGTTGAAGGTGATGCGG
TGGACTGCGGAGCAATAGTCCCGCCACCACTGCGGCGAGTCATTTGATTGGTGGATTAACGTGTTTCCCAAGAATTGGTTCACCTCGTGCAGCGTGCGCT
CGACGCGCTCCGTAGTAGCCCCGGGGTCTGCATCCATGGTCGCCATCACGAACTCGCGCGGTCGGAAGAGCGCATGCGTCATCGGCTCGTACCATTCGGT
GTTGGCGAAAGTGGTGAGCCCTTGAATGGCCCCGAGCAGATGTTGGTAGGACGTGCA