Description :
From Genome Similarity Track
Location :
Scaffold_1230:7249- 9946
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1230-fgenesh-gene-0.1Transient receptor potential Ca2 channel (TRP-CC) family protein
Pytiw_DAOMBR242034snap_masked-piw_contig_1230-abinit-gene-0.11Gene of unknown function

Sequence
2697 bases(100 bases per row)
GAACTTCTCGATCTTCCTCTCGCACGGCGACTGCCACCGCGAGTTCGTCACGGACTTGTGCACGGAGCTGCGGCGCCACCAGCTGCCCGTGGTCGTGGAC
TCGATGACCAACGTCTCGAGCATGAAGGCGCGCATCCTGGCGGCCAAGGACGCGATCCTGCAGAGCACGATCTTTCTCGTCGTGCTCTCGGCCAAGAGCA
CCAAGACCGAGCTCGTGAGCGACCAGCTCGCCTTCGCGGAAGACAAAGGCAAGATCGTCGTGCCCATTTACTTCACCAAGAAGCCCAAACTTGTCGATGC
GCCGCTAAGCAAGCTGCTGGAGCAGGAAACCCGCTCATTCGTCTTTGGCGACGACTTGAGCTACGGCCGCGGCTTTGACGAGTTGTTGCGCGAGCTTCGG
AAGGCGGGGCAAGGCCGTGCCGCGGACGCCGCGACTGTGGTTTTGAAACCCGCCGTGCAGGCCGCCGCGCAGCGGTTCATGCTCAAGTCCAAGCCAGCAG
CAGCCACAGCAAGTCAGGAAGCCCCGGCATCGATCGGGTAGGTGCATCCGCTTAGCTTCTGGATCCTTCCTTCTCTCTTATATAATCTTTCATTCTCCAA
AACTTATGGTCACTCACCAGGTGATGAACACTGTTGACTTGTGGGGAGTTGAGGACGTCGGTCACGTTCGTTCATGAGACTGTGGTCGACAGTATGAGAT
CGCGTGACACGAGCAAAACCTCCGCTAATCATAAGCGTGACGGTTTCGTCGATCTTGGTTCTCAAGCTTTCAGTAAACGCCGAGTGATCGATTTAAAGCC
CACGGTGATCAACGCCCTCATCATCGTCAGAGGTGGTGTCGTGTCTGCGCGACTTGCAGAACTGGCGCACGCGCATGCGCAGGACGCTGCCTGTGCTCAA
GAGCGGTGTGGTCATCTGCACGCTCTTCGCGCTCGACATTCGCGACACGGTCTACAAAGTACACTGGATCGGCTCGGGCGACTCGTTCCACTTCCGCACC
GACAGCACAGTCGTGCTCCAGAGCAAGTCGTTAGCGCCGGCCATGACGGCCTTCGATAACAGCTCACGGGTGCTGGCATCAGGTTGGCCGTCGTTCCTCT
CGCGGTGCGATAGCATCACGCCGTTCTGCAGTGACGGGAGCACGTTCTTCCTCAGTGCGCTCTTGACAACTGCTCTGCCACTGAAGGCCCACAGTCTTCA
GCAATGACGTCCCTCGTGCTCACGTCCACCACGCGTGTCGACTCGCTCGCGTGGGCGAGCTGCAAGCTCCTGTTCGTCAGCAAACGGCCGCCTATCTGCC
AGGAAGACATTGTCGCCAACTTCAACGCGCGCTACGCGTTCTCCAGTCGCGAGATCCCTGTGGGCTGGATGGCGCCGCTCGAGAGCCACGCAGAAGCCAA
GCTGCTGCGATTTCTCGACTTGGTCAGTCTCAGCGTCCCGTACCACAATGTCGTGTGCGGCGAGGCGTTCGAGCTCGAGAGCCGTGAGGGCGCAGTGTGC
AGGCCGACGTTCTACGGCTGCGCGAGTCCGAATTTGCCCCGAAGCGAGTTCCTAGGATTCAAGAACCCCCTAATCGTCACCTTGCAGCAGGACAAAGCCT
GGCTGACTTCGGACGTCGTGCAGTTCATGGGCATCTGCTACAGCATTCGGCAGAATTGCAAGAACGAATATGTCATGAGACACGACACGCGCGGCCGTAC
ATTACTGTCCTTCCACTCCAAGGTGAACTTCAGCTCCTTTGGCCAGCTGTACGTGCTGCTGCTCTTCATCGACGTCAGCCTACTGCTGCTGCAGTCCTGA
GCTCCGTCGAGATCCTTACATGAATGCTCCTGCCCGAGGCGCGGCAGATTCATGAGCAGCTCATATCGGCGCTCTCACGAACAGCCAGCAATCTCAAGCT
ATTCCTCGTAAGCGGACGCCGACTGAGCTCGGCGCCGTCCTTTTCTTCTTCTCATCCTCCGCGCGAGCCCCTTGCAGAAAGCCTCGAGCACCAACGACCG
CCCGAGGGCCTCTTGGAAGAAAACCTCTTCTACTCGTTCTTTTCGCGATCGCTCTATCGCAGCCAGCTCGTGGTGCTCGCGACGGTCGTCACGCAGTTCA
TCTCGTGGCTGCTCGTGCTGCCCAACTCGGTCGTCTGGACCTGGAGCGACTCGGTCACAGAGAAGCTGCAGGCGTACTTGAGCAGCATCCGCGTCTGGGT
GCTCATCCTGCTGCTCACGAACGCGCTCTGGAACATTGTCGTGCCCACGAACGAGGAGCTTGCGTACACTTTCGTGAAGGACACGTTCGTCTCGAGCTTT
GAGATCCTGCTCATCGGCGCACTGGTCTCCTTCGCACTGCGCGACAAGGTCTTTGTCATGTGTGAGATCAAGTGGACGATCGAGAAGCAGCGGATCAACG
ACGTCACGTTGTTTCCTGGGTACATCGCGCACGGGAACACGTTCAGTCTCGTATCGACGCCCGCGGACGTCTTCTGGGTCATCTACGAGCCGCTGCTGCA
CATTCTCGCGTGAAGCTTCGTGGCGCTCATACTCTACGCCGTTACCAAGTTAGTTGTCTACGCGAATGGTGGAGTCTGGGTACGGTATGTCAAGGCGGTG
TTGTCGAGCTTTCGACTCGGCAGGAAGCTCGCTGTTTTCTGGCGAGTTGTCAATAACCAGCAGCAGCAGCACATGAAGGAAAAAAAGAGACCACACG