Description :
From Genome Similarity Track
Location :
Scaffold_1195:7249- 8403
Transcript NameFunction/comments
Phyta_totarag12370hypothetical protein PHYSODRAFT_258942

Sequence
1154 bases(100 bases per row)
GATCGCGTACAGGATGACGCCGCACCCGATCATCAGCACGGGTGTATCCATCGTGTGTGGAGCAGTCGCCTCTGCGTACGCCATCGTCGGCGCCAGGATC
AGCATCGACAACAACACCTGCCAGAAGTTGTCGAACGCAGCGTACTGCAGCGCGGGGAACACCAGACCAGATATGAACACGCATGCGCTGCCCTCCCAGC
TACGCGTGTACTTGTTCTTagagaagcagctgcgcgTCTTGTATTTGTGGCGGCCCCACGTGATGCCCACAGGCTCCGCTAGACCGTCGCCGATGCCCGT
GATGAACACGAGGATGAACGTCAGCGCTCCCTGAGCAGCGAACAGCCACTTGAAGAACATGAGGATGAACATGCCCGGAGCGATGTTGCCCACGATGATC
CACTTGAGCGTGTTGGGGCGGTCCTCCGGGCGGTCCAGTGAGTTGAATTGCAGcatgaagaacttggagtGCTCACGGATGGGCTTGATGAGCACGAGGA
AGCCCAGCATGGTGAAGAAGTCACCCCACGCCAGAGCGATCGGGCCGGGGTAGTCGCTCTTGATGACCAGCGGCACCATGTACGCCGCAAAGTGCTGCAA
CTTCCGGGTGTAGTTGACTTTGAACTTGGACGACTTGTTGGTCATGATGTAGCCcttctcgtcgacgtcgcagaagcagcggcagaTGATGCCTCCGAAG
AGCGACACCACCATCATGACCACGAGCTTGGGAAGCTGCATGAGCCAGAAGTGCGGCTCGATCAGCCATTGCGGCTCGTAGAAGAACGTGAGCACGAGCA
TCACGCCACCATAGATGACCATGCCCACCAGGAAGGCGAAGTCGAACGTGTTGTACCAGTGCTCCTCATAGTCTCCAGCCACTTCTCCCTCCTCGACCAG
CGACGTCTTGATGGTGGTAAtgggctgcagctgctcgccCGTAGCGCCGTACGAGGGCACGGGTGCACGCACAGGCAGAGGCGTGGGCACGCGCCACACG
AGCCGCAGCATGACGTAGCACAGCACGAGCGCCGCGAAGGGCAGCacggcgatgacgatgcccTCGGTGGTGGTCATGTTCTCGGGCCACTCGAGCGGGG
TCGCCGTGGGCGCGGGCGTGGCCACGGGATCGACAGGGATTGCGTCCGCCATGG