Description :
From Genome Similarity Track
Location :
Scaffold_23:72475- 73812
Sequence
1337 bases(100 bases per row)
CTCCTTTGTCAGAGGAAGACTTCTAGACTCGTAGAGTCTCGTAGTATATTAAACTAAGCGGGTATTAACTTAAAGGGTCTCAAGTCTTACAGACTTAGTG
AGACTTAAGTCTAAGTGTATGTACAAGCTCTTAAGCTTCTAGTCCTGGTTCAGGGGACTACGACTCCAAGGAATCACGTGGCACTAAAGCCCAAGAGTAC
TTAGCCTTAACTCAGACACTTAACTCTTACGACCAGAGACGTCTAGAAAGACACGTGTCTAAAACTGATCAAAAGGGGAACTGAATATACTTACTGATGT
ATAGCGATAATAAACCTTACTTACGTCTTTAACGTTAAAACTACGCTACCTAGTCGAATAGTCCTCATCGTAGTTCTTCTTGTGTACCACACCAGAACTA
CGTCGCCTCTATGAAGATCCTATTACGACAGATATCCTCTAACCACAACCAATAGGGTACGGTATTACCGCTTAGCGTATGTGATACAAAAGTATGCCTT
ATCAGTGATACTGACCTCTTTCTGTGTGTACCACACCAATGTGCATGGTTGTCATAACCATTTGTGTAACCCCGTTACATGACCGGTACTTCGGTATGCA
GCTGCTGTCCATTGGGTTGCCGTGATGACAAATCGCTCTGCACTGAGGTTCTGTCCCACCACAAGCTCGTTGTGCAACATTTTCCGACCTGTCGCCATTT
CGTCGTCTAAACAGCGTATCGCCTTGTGATTGGATGCCGGCGACAAACGAAAATCGACACGACGTGCTCATTCCCAATGGATCGAGGGACTAGTGCAACA
ATCCACACGATCAAAAGTGCTACAAAATTCAATCAGTCTCTTGGAGTAATCGTAACTGTCCGATCGATCGCACGCCCTTGCGATGGATCGACAGGAACGA
TGCCGAGTCCAATTGACGTGTAATCTCATCTTCTCCTTCCCAGTGTGTAATCTCTCAAGTGCACAGCGCCGGGAACTTGCACGCATTTCACACACGAAAC
CCCATAAAAAGCACCAATGGTCAACACCCGTCACAAACCTCAAGTCGCCTTGTCTATGCGCCTCTTCCCGCTTATTTCTCCGTCTAATTCTGTGGTCGGA
GGTGGATCACGTCCCCTAGCCCTACCTAAAAACTTGCTCGCCGAGTGTTGATCAGCTGCCGAGTGACGTCGCCGCGCAGAGCCAGTCCATCTCCCTGACG
CGTTGCTACTACAGGGTGAGAGAGACCGTCAAACTTGATCACCACCTCCTCTCCTCCTTCTTCTTACCTACCCACTCAAACACGAAAATCATCCTCATCA
CTTTTCAATTGACCTCCTCACCCGCAAGCGCCCCCCC