Description :
From Genome Similarity Track
Location :
Scaffold_9:7247- 13917
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004342Protein of unknown function
Pytul_DAOMBR144PYU1_G004341Protein of unknown function
Pytul_DAOMBR144PYU1_G004340Protein of unknown function
Pytul_DAOMBR144PYU1_G004339Similar to stfR: Side tail fiber protein homolog from lambdoid prophage Rac (Escherichia coli (strain K12))
Pytul_DAOMBR144PYU1_G004338Protein of unknown function

Sequence
6670 bases(100 bases per row)
TACGTGAGCCCGCCGCAGTTCCACAAAGTGCTTCAGCAACTGGGGTTCGTTGATCAGCTTGGCGGCAATTTCAGCGTCTCGATCCAACGCGGACGGGGAT
GGGGGCCGGGCAATCTGGCTTTGCTCGGTTGGTGGCATGTGCCTCGCGCGCTTGGGGTTGTTGCTCCTGTCTTGAACAAAAAAAGACATGTCACCCATCT
TTCGTTTGGGGAGTACCACAGCATCACTGTCTTCCACTGTGACCTCTTCGTCCAGTTCTGGCTGGGTACCCGCATTGTCACCGTTCACCATTGGATCAAA
CATCGATGTGCTCACTTTCTTGCTTGCCACTGGTCGTTGACGCCCACGCACTTCAGATTGTCAGCAGAACGTGGTTCCGAGCGAGGTTAGAGGGTCGTCG
TGACCTCAATCAACAAAATGAGCGAAATCGATTGCATGTTGTAGGTCGAATCGACACTGCACGCTCGACTCTGAATCAATCCAGACGCATGTCTCCGTAG
GTGTCGGATAATGTCCGCTCTCTAAGAGGCCGGCCAGAATAACAAGCAAAGACATAGTGCCTGGTTTACCATCTTGTCCTAGGATGCAAATTAGCACCCA
GTTGTCCAGCTCCATGATTTCACCCCACGTCCAGTGTTCCAGCTCAAACGACAAGAAGCGCATTATCAAGGCCGCCACTGGTGATACAGGGACCACCGCA
CTCCGCTTCACTTCCACAAATTCGTCAACGAGAGCGACTGTCACCTTGTCACCCTTGGTGGCAACGACTTGCCTATGGTGAATCTGCCGACTCCAACCCA
CCGCGACAGCCCGCCGCACGAAAGACTCTTCCTTTGCGTTGGTGGCTCCACGGGCCGAAACAACGAGATCCTTTGCGAATGTTGTCTTCAAGGTGCTCGT
CACTTCAGCAGCGTTGTGCAGACCTTGCAGCGTAGCTGTACCCCATGGCAAACTTGTCACTTTCACCTAGAACAGAGCGTGAGAGGTCCCACCCACATCC
TCAGGACGCAGATGCAGGTACGAGCGCGAGGAAAGGCGTGTCATCGGGGAGAGAACAGAGAGTAGTTAGCGATTTCGTTTGCGGGGGCTGAAAATTCTGA
AACTAACCTAGGCTAGTTACTCGCCCGGACGACATCGCTACGCTATGGTAGGTTCTACTTTTTCTAAAAAAGCTATTTTTATCCAGCGTTCGCTTAAAAA
TCTCCAGTTCAATGCGAAGCGGTGCTGCCAACATCGACACTACACTATTATTTAGCAGTACGTTATGGTGCTTCCACTGACTAAAACGACGGGTGCTCCC
AAAATGCAGAGTAGGAAGGAGGAAATAGGGTAATCTGGAGCTACGAGCGTATCTAGAATCGCTGTTCTGTCGCAAGGGCGAGTTATAGTGCTCTCCTACA
GCTAATAGGCCAGCCGTAGTTTTTATATGGAGACGCGAGCGAATTGAAAGGTAGCCCTTTGGTTGGCCGCTGGGTTGACCTCAAATGCAAGACGCGCTTG
CCGATTAGCGTTAGCTAGGATTCTAATCCAGCTGTTCGTTAAACGCTATAGTCACGGTGCGGCGAACCCATTGGCGCGCACTGTACCACGTTTCTTCGTT
GCTGTTGCCTCTCATACCTTCGTGTGCGTACGAAGATAGTCTCAATCCGCTACGCTGATATGTATGGGTACCCTTCATCCGATGAATTGATAAGAAGACC
ATTTTTTGTTTCTTGCGGTGAGATAAAGTGGAGACCATCACTTCCCAATTAGCTTTCTAACGAGTACATTCACTCCTGGAAACTAATCAGCCAATTAAGA
CCGACAGAGCAGAGACCGTGTTTGGAATTACACATCAAAGGTCCTGTCTCGCAACACCCTCGACTCAGCATCTTCAACAACCCAGAGGTGCGACAACGAA
GTGCAACATGAATAACCCAGGTGGTGGCGAAGCAGGGCTACCTCAACCACCCGACCCTGGAGGAGCTAATCCCAAGGCTAAAGCGACAACATCGGCCAAG
CGATCCGATGCGGCTACGGCGCCCATGAACTTCAAAGCAGCGGTGTCCAGGGAGGACGAGGTCGAGAAGGAACAAATTGCGTGGACCAACCGACTGACGA
AGATCGCGACCAGGCCATGGAAAGAACAAGCGAACGATAACCTTCACCCAATGGTAAAGGCAGAGGAGGAGGTACTGGCTGCATGGATGATGGACGCTTT
AGTGCTCGATTCTTCACCAGCTTTTCTAGTGTGCACGCACACGAGAATACAACGACTCGCGTCCCTAGATTACTTCGAGACATATCTCGAGGGTTTGCTA
ATCGCAACAGTGCCTCCCATAGTCCGCATGCCAGAGCATCTCGCCGAGCGGACCCTGCTCGCACAGATGGTCTCCTCGGAAAAAGACAACACGCCGGGAC
ATGCGCTTACTTGCAGCTTAGTGAGGCAGGTAAAACGCGCCAACTACAACGGAGCAACAAGACGGATCAGCATCATTGTTAAAAATAAGATGGCAGCCGA
TGCCTGGCATCGGGCAACTATCGTCTACAAAGGCGCCAAGCTACTTTCGCTCAGCCCTTCAAAACTCGATGAGGAAGATGTCCAAATGGATATCGACAAC
GACGCGCCCCATGCAGGAGCGCTCCTACGGTACCAAGTGCGAGTGCTCACTCGTGACATGTCTGCAACGATCGTTGAACAAGTTCTTGGTCTGAGCACTG
ACTACGAGATCATTTCGGTCACGAGACAGTCAACACGGTAGAGTAAAGCATACGACTCCAATTACTATCTGGTTGTGTTCGAATCGGATACATGCCCGGC
TCAGCTCGAAGGTGTCACTCATATCACCGCAGGAAAATACTCGGTATATATCCATCACTTCCTGCGTCACAGCAGGGCCCCGTGCTTTCGATGCTACGAC
CCCAATCACTCAAATAGCCAATGCGAGGCAGCCGCAGGCGTGAAGGCGGAGGAGCACCCGCGAGAATTTGAAATGCCTCTTCCCCCGACGAAATCAATTC
CACGACAGGCAATTAGGCATATGAACGCAGCGGAGCGACTGAACCTAGTCAACGATACGACCAATGCGCTCAAATTGACCAGAACCAAGCTAAAGGCGGC
AGCGAGCAAGAAACCGCTTCTACACAAACCGGACGCGACATCGGCAGCACAACATACGGACTTGGCCCAAGCAGTACCAGAGCCGGCTGAACCAACCGTA
CCAAGCAGCGAGGTCGCTACCAATGACAGCAACGGATGGGTCGATCCAGCGAACAGTAGGAAAGGAAAAAACGGAAACGCAACAGTTCGGGTAAAGGACA
GTTTTCGGCGGCGGCGTCAGATTCAGCCTCGAGACCAGCTGTCCTCGACAACACAAGTGCCACCACAGCAGCGAAGAACTCTGGCACAACCACTAGTACT
GACAAAACCGCCAAAAGAAACACCAACGGAGCCTCAACGGCTCCGATTACGGAAGCAACAGTTGCTCAGAAGCAACAAATTGACAAGACATCCGTCGTGA
GACCTGAAGCGAACCGTTCCAAAAAAGCGGACAGATCCAAGAAGACGGCTGCGACAGCACGGCGCACAGCAGAAGCAGCGCTAGCGGCAGTCCTCGCTGG
TGAAGACTACAGCAAGCAAGCGGGCGAGCATGCACAAGCTGAGACCGAGACAGAATCGATGACGGTACTGCCTGACGAAGCCTTTGCCAAGGCGGAAAAT
GTGGCACAACAAGACGAAGCAGCAGTCAGAAAAGCTACCACATTACGCGAGCTCAAAACTACTGCAGCACAAACAGCCAAAACGCGGTACCAAGCGGAAG
CTGCAACCGCGCACACTGAAGCCCTGCGTCTGGCCGAAAGAGCGGACAAAGCGGACAACGGATCAGAACTACCGCAAGCTGAACGAAACGCGGACAAAGT
CCGCATTCAAGAGATTATGAGAACGCTAGTGGTGATGGACCAACAACGAGTTAAAGCAGAAACTGAGGCCGAAGATGCCAAGCTTTAACTCCAGAAAGCT
ATAGCCAAGGCGAAGATGTAAGAGGGTGCTGTTCCAAATAGTCCCTAATGCATGGCACACACGCTTGGCGCGTACGAGGAAGTGATCTCCCGACTTGGAT
GGAGAGAAGACGACTTGAGGACTTGGAGGTAAAATTGCAACTGAATTGAAATGAGCTTATGGTTCCTGTCGCTACATACAATTGATCCTCAAGGGCTCCT
AGAGGTTTTACAAGTAAAACCTACACATGTACAAATAAAACCTATGAACCTGGTATATAAAACCTTGGGTACACTGAGGTTGAACCTAGGGGATCTGCTG
GAAACTTGAACTTGAAGCACCGCGGAGATTCCCTGCAAAGTGATTGGCTCCCGCCACTCTCTTCAGATGGCAGAGACACATCGGTCTCGTCACCTAGACA
GTTTCCCAAGTAGGAACCATCACTCTGTACTTGATTAGCACATGGACACTTGTGACATCATCAGCTGACGTCATTCGTACATGTGGGATCTGTTGTACCG
TAATCCCTTTGTTATTTGCTCCCACAATGCACGCTGAAGGTGATATGCCCAATACTAAAGTAGGGCACATAAAGTGTAGCAGGCCTGCCTGTTACTCTGG
CTTACACGTGTGTGCTGTGGAGGAAGCGGTAACGACTAAGTGGTCGCACTTAGTCGAGGAGGAGGGTTCTTTGTGTTGTAACGCAAAGATGAGAGTGAAT
TACCATTTAGAGGGTTGGCGGTAGCCAGTGTGGTTTGGAGGTACCACACAAATATCCTAAAGCAGTACCAAAAGTCCTAATCAATGGTTTGGAGAACTCC
TTTCTCCCAATTGGCTAATATGGTTATCTGTTTGTGCATTATTAAACCAATAGAATGCCTCCTTTAGAGTGTCAAAAGGAGTCAGGTTGACATCCTCTTT
TGTCAACCTGTAGCTGAAGGCTTGTACCAACAAAAGGGGTACATGTAGAGACGGTGCAAACCTAGTCAGTAGTAGTTCTGACACATTACGACGCCCATTT
TTATCTCACCCTATCCACAACCCCTATCTCTACCAATATATCAGAACAAAAACCTCACCCCTAGTGTTTGAAATTGGTGAAGCTCTACAACATCACCTAA
CCCATGATAACATATCCACAACCCTTATTGACTACCTCTTAACCAATAAAAAAATATTATTCAATCAAAGATTCAACCATAGACTCAAGCATTAGCCTCT
CATACAATGCTTCAATAAGAGGGTAATATTTATTTTTCTAATTGAACAATCACCAACCTAATGTAACCAAAGTCCCAAAAGGTGATGATGATGATAAGAA
GAATCTATTTATCCGTGATTTAAGATTCTCTAAAGTCGATCAGCCTACCTAGTAATACTGGTTTGCGTGGTCGATTGTAATAAGTATGGTCGAGAGCCAG
GAGCTTTAGCATCTGGTCTCTTCGTTGGGCGAGAAGCTGGTTCGCATTCCCCACCAGTCGTCCCGACGATTTCGCATCCATTGCTATGTTTGCTAAACTG
TCGGCAGCCTTGTTGAAGTTGCGCTTGACGTGCTGCCAGTGTATTCCGTTGAATCCTCTGAGGATCCTGTTGATTTCTGCAATTTCTGCTGCAAGGTTGG
GATTGCGGATTACTGCTGAGCCAGTGAAGTGGTTGATGAGTAGTTGACTGTCGCCGATAACCTCAATGACTGAGGCTCCTGGATCGCCGCTGCATTTTGC
TGCCACTAGGCCGAGACTTAGCGCGTTGACTTCACAATAGTTATTTGTGACCCCTGGTCCGTGGTACGTGTATCCTCCTTGGACTAGGGTCCGTTCATTT
GTAGTGGGGTTACATAGTGAAACACACCACCCACTGCCTCCAGTTCCTGGGTTTCCTCTTGATCCGCCGTCGAAGTGGATTCGCAGTGAGCGAGTCTGTC
TGATAGGACTTGGCTCACGCTGTCTTGGTTGCTTAAACACCGATAGAACTTGTAGAAAGCATATACCCTCAATTTTCAGCTCGGGCTTGCTTCGACGTAC
CAGTACAACTGCTTCGCATTGGCGTACTATCTCTCCATATGTGAAGTACACATTCGCTCGTGGTGCTGTGCTGGTGCCAGAAGACTCGTTCATTGCGCCG
CAGCCATAGTAGACTTGTGACCACACTGGTCACAATCCACCAAATGGAGTCCAGTGCTTTTGCATGGTCGTCCGTGAAGAAACCGTACATTGATTGCACT
CTCTGGATCAGTTGTTGTGACGGCGGTGGTGTTTGTCTCGATGTGACATACTGTCGTACGTTCCGTTGGTCATAATGGTTCTCTCCTTCCCAGTGAGTCC
ATACTTGTTGCCATATTGCTTGGGCGTGTGAACATTCCCACGCAATGTGGGCAATTGTTTCCTTCAGGTCTTTGCAGCTTGGGTCAGCTTTACATGTGTT
GTCGAGTTCTCTTCCTTGATAGTACAGGTTCAATTGGCCTGCGGACATTCTGTAGTTGAACCACACTTGGTAGCGCGTCATGCTGTTATGGGATGCCCAT
AGTTTTCTTGGTGTTTGGTCGAGGCATTCTGCAATCCATGTGTCCCGCGAGACTTTGGCATCCAGCCGCTCGATGATTGGCCGCAGTAGTCTCTTCCTGG
GGCTCCAGATACGCCGTGCTCTCGCTTTGTTCAGCTGTCGCGTTGCCGTTTGGGGTTGACCGGTTCCAGT