Description :
From Genome Similarity Track
Location :
scaffold_17:724610- 726735
Sequence
2125 bases(100 bases per row)
CAACTGCCCGTGATGGTTAAAGCGTAATTGATGTAGTGATTGTTTTGTTTGGACACCTTTTGCTTTAACTGTGTCGAGCGAATATACATTATTATATGCT
AAATCATTTCCACAGACAGCTCGGCCATTATTGTTGCGGGAAAGGTCCATATTATCGTGTCAACCTCATGCTCACGGATGACGATTTCGTTTGCAAATTG
TGAGCAGAAAAAAGCAAACGTGAAACAGACAATCGGAAATaaatttcaaaagaaaaatttGGATTGAAAGTGTAAAAGATGTCGGTGTCTCCATTTTCTT
GACCTCTATGGCTGGATAAAACGTTTTGGCTAGACTGCTTATGATAAATTAAATTGATCATGTCACTTTAAAGAGCCATACTTAACCATTACATAAAGGA
GGATACCTGTGGGACACATCACCTTCGACGTACATTGTGGGGTCAAAAATTAAGGGAGTCCAGTAAATTAGATCCGACATGCGCGTGTGATATCATTGGA
TAATGCCATGAATATCCTCTGTACTAATTGATACGGGATGGCAGATCCCGCCTTGGAATCTAAACTGGTGATGAGACGACGTGCCTTTACCATCATAAGT
GAGTAGCATGGGCGCCGCTCACTTTGCGAGGGAACTTCCATGAAGACTTTAAGTACAAGTTTCTTGAGGTTCCTTCGAGTTCAGCCTCAGTGTATCGTTT
ATATATCAGGTTTGGCTTTAATTTCTGCATTTGCAAATTTTACAAACTCTAGGAAGTCCAATAGGTATATCCATATAGCTTCAGAAACGACGCTCATTTT
TCATTTTAACGGAGTTTTgcgaatagaagaccttctactattacaagcccccatcaaattttcgacaatgttctagaNNNNNNNNNNGGGGGGGGTAATG
AGCATTgttgtgcggcacttcggtcgaagcggcatTTCTCTCCTGGacagagctgaagctgcagctgcagctttcacgagtgttcttgctACCTAACCAG
TCATATTGCGAGCAATCGCTATTTTTGCCATGCGAGGCAGTCACAGTAACAGTCGTTATGGacggcctccgcactggcctGGCCGGAATGGAAGTCCTCT
AtgtgcacccgtcttcttttgaagaagcagggCATGTGGTATTGAGCTTCGGCTTAGCCCTGAGAGCTCCGTGCTATTAaatacggaacgtgtatacaag
ccgggcttgctggtcgtgaaagcgaccgtgaagggctttaagaagccatgaaagtcctgatcgactccggggcactgggcaattatgctcgacgctccac
gatagaagacagtcagctgtatgctggggcgctgaaagcgcgctCGAGTGACATCGCCACTGTGCCGAAGGTCCTTGTGGACGTTGATGTCGAGTTTctt
aactttgatagcgtggaaagcTGCAGACATGGACTCaagatatgacctcatccttggtatggcatggttggaacaccatgagccatagatCGAGTTGAGG
TCGaataccttgggcgctacgcgcacgtctcctggtggagctttggtgagatgAACCCACCACTGCTAGGAGGCGAAAATGTTATTGGCGCggacactgg
accgggacgttCAGCGTGCTGGAGATCTGATTATCTGAGCTAGTGAATACCGAATGTGTATCGTACAGGGGTCTCAAGCATGGCTGGCAGGCTGAACGTa
tagtggcacgtagcccactgagcgctgcttaagtatcggagcagtcgcttcgTGCCACgagtggtatggtcggacgagatctgaggcatcttgagcaaag
cacttcagatgcgcgtggagtggcacttcatccactggacgaagactgcggagctagcagcttttcgtctgatgttattaataacatcaggaCCCCGGTA
GGGCAGTAAGTGAGGCtaacaccggacgacgctgGGTGCGGGTCTCGCCGAGACATACAACCTTTGTgaagaggcgacagcgacgccgtatgctagctgc
aagacgccaggcgTCGATTGACCCATGATGTGCCTACTggagacgatagcgcacagctatacaccctcgtcaacgatatgacggggaggaagacggcgac
gttaccctcgaggctattcctgcgg