Description :
From Genome Similarity Track
Location :
scaffold_87:72458- 74206
Transcript NameFunction/comments
g10575.t1 ATP-binding Cassette (ABC) Superfamily

Sequence
1748 bases(100 bases per row)
AAGTACGAGGAGTTCATCAACCCGTGCGTGCTCAGCTGGACCGACCTGAGCTACGCTGTGCCAGGCCAGAAGTCGGCCAAGAACCCGTACGGCAAGAAGC
TCATCCTCGACAACGTGAGCGGACGCAGCGCCCCCGGCGAGCTCACCGCTATCATGGGACCCTCCGGCTCGGGCAAGACCACACTCGTCGACCTGTTGGC
CGATCGCATCAGCTCGGGCCTCGTGACAGGAACGATCGAGCTGAACGGCGTCGACCGCGTGACCAAGACGTTTCGCGCCGTGACGAGCTATGTGGCCCAG
GAAGACACGCTGCTCGGGTCGTTTACCGTTGTGGAGACCATGAAGATGGCGGCCAAGCTCAGTCTGCCGAACAGCGTCGTGATGACAGACATCCACTCGC
GCGTGGAGAGCGTCATGGACGCAATGGGCCTCGCAGCCTGCCGGAATACGTTGGTGGGCGACATTTTCCGCAAGGGGCTATCGGGCGGCCAGAAGCGGCG
TCTTAGCATCGCCATCGAGTTGCTGTCGAACCCCAGCATCCTGATCCTCGACGAACCTACCAGCGGCCTCGACTCCAGCTCCGCCCACAATGTCATGAAG
TATATCCTCAAATTATGCGGGGAAGGCAAGAACGTCATGTGCACGATCCACCAGCCTTCGTCGTTGGTCTACGACATGTTCACGAATGTGATTGTGCTCT
CGGGAGGCCAGACCGTGTACTGCGGCTCGCGGCCCAACATGATCCCGCACTTTGCATCCATTGGCTTCTCCTGCCCCAAGTACATGAACCCGGCCGAGTA
CTTTGTGAACCTCGTGAACACGGACTTTGAAGACCACGTGGACATCACCAAGTTGGTCTACGCCTACGCCCAGAGCAACGTCAAGAAACAGCTACTGGAC
CAGCTCTCGGCGGATCGAGTCACGCTGCAGTCTCTGCCGGACATCGAGCTCAGACCTTCGTCCGCTATGCGGCAGTTCAAGGTGCTCATGTACCGCAACA
CGCTCAACAACATCCGCAACCCGGGCATCTACTGGATCCGCCTCTTCATGTACTTCTGCCTGAGCTTCATGGTGGGGACCATGTACCTGAGCACGAACAA
CGAGCTGACGGAGGAGGACCTGGTGCCGCTGCTGTTCTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCCGTGCTGCCCTTCTTCATCGAGCAGCGC
GCCGTGTTCGCTCGCGAGCGCGCCAACAGCTCGCTGAGCGTCGTGAGCTACGTGTGCGCCAACTTCCTGGCGACGCTGCCGGGCATCTTCGTGATCGCGG
TCATGTCGACGGCGCTGGTGGTGCTGCTGGCGGGACTGAACGCGTTCGAGTACTTCCTGCTCAACCTCTTCCTGTCGCTTGTGGTGTCCGAGTCCATGAT
GCACGTGATCGGGTCTGCGGTGCCGCACTACATCATCGGCATCGCGTTGGGTGCGGGCGTGTTCGGCATGTTCATGCTGTGCGAGGGTTTCATGGTGCCT
CGCGCCTCCATCCCAGACTACTGGATCTGGGGCTACTACCTGGCGTTCCACTCGTACTCGTTCGAGTCGTTCGTGTTCAAGCAGTTCGAGAACGAGACGT
CGGACGCTGCGAAGGCCATTCTGGCCAAGTACGGCATGGAGAATGTGGACGTCATGCAGGACATGCTGTATCTTGCAGCCTACATCGTGGGCTTCCAAAT
CATTTTCATGTTTATCCTGTGGAAATACCACACCGGTCGTCGCTGAAA