Description :
From Genome Similarity Track
Location :
contig_24:724579- 733642
Transcript NameFunction/comments
g5525.t1XP_009529822.1 hypothetical protein PHYSODRAFT_560612 [Phytophthora sojae
g5526.t1KUF81399.1 ATP-dependent RNA helicase DBP9 [Phytophthora nicotianae
g5527.t1OWZ23174.1 Kinesin [Phytophthora megakarya
g5528.t1hypothetical protein

Sequence
9063 bases(100 bases per row)
GAGACATTCGTCATCGACCACGTGCGAAACCTTTCAACCTGGCAGAAGCAGCAACGTGCGATGAAAGCCGGAAAAGGGAAGCAAAAGAAACTCTTGCCAC
TGCACTATGAATCACCTGTACAAGTTAACCAGCCACCGTTTGACCAGCTCACGCATGAAAGCGAAGCTACGAGCACGTTTTCCTACGAAGCGTACGCTCG
TCGCCCACCTCCACGATCACCCTCACTGAGAGCGTCCGCGTCAGCGCCAGCTTTAATCCACGCCAAGTATTGTTCGCACAGTAAACCCGACCCAGCGACA
ATAGCAGCTGTAGCGAAACTCAAGAATGCCAAATTGCAGCAACGCCGAAAGGAAAAAGAGGCTGAAGGGTTAGCTCGACGAGCACGACAGCAAAGTACCG
AAATCGCGCGCGCGTTTACCGCAAGTGTGGCAATGATATCGCGCCATGTGCACAACGAGGAAGTGCGCGATCATCGTGAAAATGAGCTTGATACGCAAAT
TGCTCGCACCGATCAAACTCGTCAGTGGAACCAACTCCACAAAGCGCACTGCCAGGCTATCGAGCAGGATACGCGTGAGCAACGAGCACGTGAGGTGTGT
GCCATGAAGGCTTTGGCTGAAGAAGAGCTGCTCCTATCGCGCGACTTCCGTGCGCTCCGCGAGGAGGTGGTGCGCCGCAACAAACCTCTTTTCGCGCTAT
CGTCCTCCACGACCACTATCTTCCCTGCGCCGCCAGAAATCCTAGCTGCACGCGCCACAGCCAGCTCCTCGGCAGACCACAGACGTCTTGCCCGCGTGGA
ACGAGAACACGCCGAGCACATGCGCAGTCTGCAGCTACTGGACTATGCGTACGATCGCAAGCGTATCCTGGCCGCCGCACTGCAGCCTCGTGCCAATTCC
GCTTTGGTAGAGGTAGACGTGCCCGACGAAGAACTACCAGCAGACCGTCTTGTGCAGCTCGCAGGTGATGAGTTGTGGCGACAGATCCAGCAGCAACTTG
ATGGAGACCCTGACAACATTGCGCTGTTCGTACCACCCAGCAACTCACCGCCAGCAGCTCTTCGTTACTTCGGCACGAGTCGACCCATTTCGCTGCCGGC
ATTCGCATCAGCTGTCGATCGTAACCTTCAGTAGCGAAGCACAAGACGAAAGAGCACCACGAGCGAAGCAGAAAACGTGTATCTATTTGAAAGCAAAGCA
GGAACAAGGCTCCGTGATAGGTAACAGTGCTGACACGGATCCAAGTTCCAGCTCCTTAATGAGTAGCGCCCTTGCTCATCTTGAATTTCTTCTTGGCAAT
CGTTTTCGGGTTGAAGTGGCCCTTGCGGTGCTGCTTCTTCCACTGCTGACGACCGGCAGTACTCTTACCCACGCCGCTGTTACCATAGCTGATACGATCC
TCCACAGTCTGCTTCTTGTCATTATCAGCGTCAGGGGCCACGAACGTGTGCAACGGGTCGTTGTCCGTACGGCGCTTGCCGTCGGCAATGCGTTGCCGCT
TGTTGTGTTTCTTCTTGGTGCGTGCTGGTGCCGGTGGCTGCAGCTCGATAGGCACAAGGTAGTCCGGGATCGTCGCCAGATGGAGCTGCACTGGCGCAGA
GCCCACCACCTTGTCGTGCTCAAGCATGTTCAGATCACGCGGGTTAGCCTCGAAGTGTGCTGCCAGGCGTTCGGAGTTCAGCATCTCCTTCTTCACGTCA
GCCAGTTGCGCCTCGCGCACGGCCACGCGCGTGACAGCACGACGGACGTCCTCCACACGGTAGCGGAAGCAGTCAATCTCCTTCAGGTCGAAAGCTAGCT
CCGCAGGCTGTGCGAGAACATCGTTTGCCTCGGAGCGGACGGCCTGCTGCTTCGCCTGCACACGCTTCAGAGCGCGTTCCTCCTTGGGGGAATCCTTGGA
CACGAGAGACAGCGCCGTACCAGAGGCACCACCACGCGCGGTACGTCCGATGCGGTGAGTGTAGGCGCGCACGCTTTTCGGGAAGTCCACGTTAATAACA
AACTGAACACCGCGGAAGTCAACACCACGTGACACACCGTAGCTTTCATCGTCAGCACGCCCACGCTTGGAGCCCACCGACTTCTTCTCCTGCTTCTGTT
CATCAGCATCATCTGCCTCGTCATCGTCACTGTCCATGGCTTCATCGTCCTCCTTCTCACTATCGTCATCCTCTTCCTTGTCACTATCACTATCATCACC
CTTCTTTTCGTCCTCCTCCACAGCGTCCGATTCAGTGTCAGACTTCTCTTCGTCGTCCTCCTTCTCATCAGCGTCCTCGTCTTCTTCCTCCTTCTCTTCG
TCCTCTTCGTCCTCTTCGTCCTCTTCACCAACGTCGCGATCCACGCTGTCGTCCGTGGCAATAAGGTAGTCAAAGAGACCGCGGTTAAACTCCTCAATAA
TGTGCTGACGCGAGTTGTGCGGCAACTTCGCGTTCAAAACTGCGCTCTTGATCACGAACTGCTCAAAGAAAAGCTTGAGCCTGTACGCCGCCTCCGTCGA
GTTGACGAAAAAAATCACCTTGCCGCTCACGACGCCCAGGCGCAGTAGCGCGTACAGCAGCAGGTCCTTGTCAGCGGGTTTCACGGGCAGATAAAACTGC
TGCAGTTTGCCGTCCGTGGCTCCCTCCTCGAGCTTCACTACCGCCGGGTTGTGCAGCACCGAGCGCTTAAGCTTCTCCAGCTCGGGACTGAGCGTCGCCG
ACATGCAGAACGTCTGGCAGGCCTTAGGTAGCGCGTTGAAAATCGTGCGGATGTCCTCTCCGTACCCGAACGACAGCACCAGGTCCGCTTCGTCGATGAC
AACGGTCTGCACCGATTCTTTGAGCGTCAAGTTGCCAGCCTCCAGGTGCGCCACAAGGCGGCCAGGCGTGGCCACCAGCACATCGGGGGCGTCACGCAGC
AGTGCCTGCTGCGCGCTCATGCTCTGCCCGCCCAGCGCCAGGAGACTCACCGTGTCCTGGCAGTAGTACATGAGCTCAGTCATGTGGCGGCGCGTTTGCT
CCACGAGCTCCTTGGTGGGCACAAGCACCAGCGCGCGAACGGCCGGGTCGCTGGCGGGCGCGTCCTGCTTGTGCTGCAGGATCTTGTGCAGCAGCGGCAG
CGCGAAAGCCGCCGTCTTGCCTGAGCCCGTGCGCGCACGCACCAGCAGGTCTTTGCCCTGCAGCGCCAGAGGGATGCAGTGCACTTGCACCAGTGTAGCG
TGCACGAAGCGCATCTTAGCCACCGCCTTGGTGAGGCGGCGGTCTAGGCCGAACTCGCACTCGGCGAAGGCCTTCTGTCCATCCAGTAGCGTCTCGCTCA
CCTTGGGCTGCGCCATCTTGTCAAGTGCTCAATTGATGGAGTGAAGCGCATGCCGCTTCGCTTTGGTTGGTCGGCAGCTTCAATGGTGTGTCAATACACC
AATACGGTCAATTCACCGGACATCGGGCAGACCATCACTCCTGCGCGCGCATTTTTTGAAATCGTGTTCAAATCGAATCTCTGCTGGCGGATGACGGAGC
TAAGTAGCAGCGAGCGCCGCATGTCGTCGTCCTCGGTCTCCAGCGTGCACGACGCGCCCCCGCCCCCGCCCACTCCCACGAACGTGCAGGTGGCGGTGCG
CTGCCGGCCGCTGAACAGCCGCGAGAAAGCCTCGGGCCGCGGTGCTGTGGTGCAGTGCAAGCCCCACTCGAACGAGGTGGCCGTCGCCAAGCGTAAGACG
TACACGTTCGACCGCGTCTTCGGGCAGTATTCGACGCAAAAGGACGTCTTCTCGTCCGTGGTGCGGCCGGTGGTGGACGAGGCGCTGGCCGGCTACAATT
GCACCGTGTTCGCGTACGGCCAGACGGGCACGGGCAAGACGTACACGATGCAGGGAGACCTCTCTCCAGACAGTGAGACGGCGGGCATCATCCCACGCAG
CGTCCGCTGCATCTTTGACGCCCTGGAAGCCAGCGGAGAGGAGTTCAGTGTCCGCGTGTCCTTCCTGCAGCTATACAACGAAGAACTCAAGGATTTACTA
GACCCGGAGACAGACAAGAAGCTGAGGCTCATGGAGGATGTCAAGCGAGGCGGCGTCTACTGTGTGAACCTGCTGGAAGTCACGGCCACAACGGCCAAAC
ATGTGTACGAGCTCGTGAACACAGGAGTGAAGAACCGGGTCACGTCCGAAACGCTTATGAACGAAAACTCCAGTCGCTCGCATAGCATTTTCACGATCAG
GATTCACAGTAAGGAGCACAACGCTGCGGGTGAAGACTTGCTGCGCGTGGGACAGCTGAATCTAGTGGATCTGGCAGGCTCTGAGTGTGTGGGTCGGTCG
GGAGCACGTAATGCAAGGGCACGCGAGGCTGGCACGATCAACCAGAGTTTGCTTACGCTGGGACGAGTTATCACGGCGCTGGTTGACAACCTCCCGCACG
TTCCGTACCGTGATAGTAAACTTACGCGTCTGTTGCAGGAATCTCTCGGTGGGCGAGCGAAGACGACGATTATTGCTACATTGGCACCGTGCGCTGATAG
CCTTGATGAAACGTTGAGTACACTGGAATATGCGTTCCGAGCGAAAAACATCAAGAACAAGCCTGAGCTCAACCAAAAAATGACCAAGGCGGGGCTGCTG
AACGATTTTGGAAGCGAGATTGAGACGCTCCGTGCGGCCCTGCGAGCTGCTAGACTGAAAGACGGCGTCTACCTCCCGCTGGAACAATTTACTGATATGC
AAGAACGACTTGCCGGCCAGGGTGGGCAACTAACGGAGCTGGAGGATACGCTGAAGGCGAGGGACACCGCTTGTAAAGAGCTTGAGGAAGCTGCTGAGAA
GTATGCGAGCGAGGTAGCAGTTCTTACGCTTGCGAAACAAGAGGTGACCAGCAAGTTGACCGTCACGGAAGACGAATTAAGCTCTACGAAAGAGATGCTG
GAGAAGACAACCCAGGAGCTGCGAAATGCGCAGGCCGTGCTGAAATCTTTCCAGGACAACGAACAGGTGTTACTTGCCAACGGAGCTACCGCTGCAAAGC
TATACAATGCCAGTGAAGAGCGTGCTTCACAGCTTTTGACGAAGATCGGTACGTAAGGCTACCTTTGATTTTTTGAGTTCTTGGCACTGGTGACCCACTA
CCGACTAACTCGGTCATTTGCTTTGACTAAAGAAAACTCCCACCGAGCAGATGAAGCCAACACAGCGCTGGCAACTTCGTATCGTAGTGAGTCCCAGTCC
CAGATTAATGCGTTCCTGGAGCGACTGGCGAAGCATAAGGAGAGCCAAGAGGGCATGTTTCAAGATGCGTCCAACGCTCTGCATGAGCTGCAGAATGGTC
AGTCAGCCGACTTGGATGGTTAGTAACAAGTCTGAATGCTCTGCAGAGCCTGGTTGAGGCACGGAGAGTGCAGACTTCCGATTCACTTGCTGAAGACAAC
ATTGTAAAGCGCGGTCAGCGCAATGAAATGGCAGCGTCAATGAACGAACAACAGAAGGACATGCAAAAGCAGCTCGAGAAATTTGTTGAGATGTCAAAGA
CCCACACAACTGCTATTGTGAAGGACCTGGCCACGTCTAAATCACGAAATATGTCGTTTCTGGAGACTGTGCAATCAACGTTAGAGGGATCTCGTGAAGA
ACTGAACAGCTTCCTGACTGAGCAGAGCGATAAGTTGCTAGAGCTGCAAGTAGCAATCGACATGTCGGTTGAAAAGCAGACAAAGGAACTCGACGAAAGC
AAGACGGCGCTCACAGCAGCGCTGAAGGACAGTCATGATCAACACCAAGAGGAGCTGGATGGCATGAAAGTCCACCTCGCTCAGTACATTGAAAAGTGCA
TCCAAAGCCAAACACAGAAACTCAGCGAGCAAACATTGCTTATCGAAGAGAATGCGAAGAAACAACAGAAGCAGCTTTCGCACGTGCAGACTGTCACGGA
GATAGAAGTGAAGGGCTTCGTGCAGTCCATGGGTAGTCAATCCTCGAAGCATGAGAGCGAGACGGCTGCACTTCGCGAGCGTTTGTCTGAAATGCGAGGT
CAACTCGGTGAAACCAACGAACGACAAACAGAGTTAGCCCAGTCTCACGAACGGCTCCAAGCTATGTGGAGTGACGATACTGCTGCGCTTTGTAAGAAGC
ACACCGAGGGGATGTCTAACTTGATGGGGAAGCACACGAAGATAGACACCGAAACTTCGACTAGGAGAGAAGGGCAGATGACAAAGTTCATGTGTGATCA
CGAGGATCTCCGACAACTTCTGGACGGAGGATGCAACACTCTGGAGAAGGGACTACAAAACCAAATTTCAACACGAAGGGCAAGATTGACTCTGCCTCCG
CGTTTGTCAAGGAGATTATTGGTGAAGTGACCGAGGCTTCCAGCCAGCAACTGCATGACATGGAGAGCTACATGAAGAAGCGAAAGGTAAGGCACAAACC
TATTGTGTATTGATAAAATCAGGACTATTGCTGATGCGCGGACATGCTTTTTTTATGATCAGGTTAATGCACGGACGGGAGCTACACCGATGAAGAAGGA
TGATCGTCCATTCCCCAGCTTTGAAGCCACCGAGGTTGACGCTGAGCAGTTGTATTCTCTCGAGAATTCGTCACGCCACGCCAATTCATCGAATACCGAG
TCTATTCCTGGTCGCAAGCGGAGGAGGCTGAGCGATGCCAGCACAAGTGCAATTGACGACGCCACGCACGGCGTCGAAGACACCACCGCACAAGCCCAGA
GCGACGCTCCGGTCAGTATTATTGAGACCACCAGGACTGCCACTGCCGGTACTTCATCAGGCAGCAGTCAGGAATCCATGAACCTCAGGTCGGAAGCGGC
TGGTGCGGGGTCGAGTGCCACTGCAAACGCACCTGAGACTCAGACGGAGGCTAAGACCACTATACCCGTCAATGGTACCCCATCAAAGATCAAGACCAAG
GCACCCGTCACTACCGGCAACCGTACCCCATCAAAGATCAAGAAGATGGCATCATCTGCATTGCACAGGAAGAAGCCCGCCGTTGCCCACTCGCACAGGA
GCATGAAGGTGCCCAGTGCAGGCGCTCGCAAGATCACCAAGACGTCAACCCTCACCGCCCCGAAACGATACCGCGCTAAGTCGCCCCTAGGCGAGACCAC
GAGCTTCCGTTAGCTCACTCATCATCTTGTAACCTTATCCGCTCGATGCGAGCGTGTCATTTATTTTGATGTCCATGCAAAGTTGCCTCGACGCCATTTG
TACGTGACGTACCGTAGGTTGAAGTGGCCCTGCCCCGTGATTGGTAGAAAACCGTGATGAGTGTAACGGTCGCGATCCTATCCTCAGCTCATTTGACATC
TGCCGCCATGAAGGACGCGGCATGGAAGAAGGCGGACGTCGTCGCGACGGCTGACGCCTCTGTGAAGCTTCCGCAGGGCAGACGCCGCTACTTGACGGCG
TTCCTGTGTCTCTGCGTTTCTACCATCTGCTACGCCGACCGTAAGTCCGCCTGCTGTGCCTTTTGCCATTGAATCAAAGTCTGATGCGATGATACAGGAC
CAACATGGGGATCGCGTTACCGGCCTTCGTCACCAACAAGAAGGAGCAGGGTGAAGTGCTGTCCGCTTTCTTCTACGGTTACATGTGCACCCAAGTTCGT
CACAGCAGATAGTCGAGCCCAGAAACAGTTCTGATGCTAGTTGTGTGTTTCTGCTGCTGCTCTGTAAGTAGATCCCTGGAGGGTATTTTGCTGCCCGATT
CGGCGCCAAGGGCGTGCTGCTCACGGGGGTTATTGTTTGGACGATATTTGTACGTACAGTAGCCATTCGAGTGCTTGGTGCATTCTCTGATGGATTTGCT
AAACAAAATCTCTCTCGTTGTGCTATGCCAGGACATGTCGACGGTCGTGGTGGCCAAATGCCTCACATGCTTGTTCTTCACGAGAGCAGGCATGGGACTT
GGAGAGGGCATTTTGTTCCCGTGCATGCACCAAATCGCTGGTGCGTGGTACCCGGTCCAAGAGCGAAGTCGCCTGGTATCGCTGGTGGCAAGTGGCTCGG
ATTTGGGCACCATCTCCGCGCTGCTTATATCGCCGGCAATCATGGCGGCTAGTGGCTGGGAGCGAATTTTTGTTGTCTTTGGAGTGCTCAGCTTCATTTG
GGTCGTGGTGTACTCGATCATGGGAGTGAGCCGACCCGAGTTAGATCCCAAAATCACCTCGGAAGAACGAATTTTCATCGTGCGCAACCGCACCGTCGAT
CCAGAGACGCACCGTCGTCAGACCTCGAGCGCGGAAATGGACACTCATGCCATGAACTGGCGTGTGCTGCTGACCTCACGCCCAGCGTGGGCGATCTACG
TCGCGCACATGTGCTACAACTACAGTTGGTACATTCTGCTGGGCTGGATCCCTCAGTATTTCAACCAAGTCCTGAACCTTGATTTGACCAAGAAGGGCGG
GTTTGCGGCTGCGCTGCCCTACATGTGCGGCTACACCGGAACTCTACTCTTTGGCCGTCTGGGAGATCTACTGGTCACTCGAGGCTACCGTGAGCTGCAC
GTGCGACAGGCCATGAACGCGTTTTCGTTCCTCGGGTGTGCCTTTTTCCTTTTCTCGCTACGTCTTGCGAAGACGGCGCCAATGGCAGTTGCCTTGCTGT
CGCTCACGCTGTTCACGAGTCGTGCTGCAATGGCTGGATATTGGGTGAACATGATCGATGTGGCGCCAAACCACGCTGCACACGTTATGGGCGTCTCCAA
CACCTTTGGGACCATCCCGGGCATTATTGGAAACGTGGTCACGGGTGCCATTCTCCAAGCGACGGGGTCCTGGGACCTCGTGTTCGCGATCGCTGCCCTT
GTTCTCGTCTTTGGTGCTGTGTTCTTCCATTGCTACTCCTCTGACAAGTCGATCTACGCGCGTCCTACCGGTAGCAGCAGCAGCAACGGAGACGGGTACA
GCAGCGCAAGCACAATCTCGAGCAGCTTCCCTGGCAGTCCCAACTACAGCCTGACTCTTTCATCGTCGATTCCTGAGCTTCGTGACGAGGAAGAAAGCCT
TCTCGAGAATCCAATGTGAGTATGGATTGCGATAGCTGTAAAATGACGCTGTCATTAACGTTA