Description :
From Genome Similarity Track
Location :
Scaffold_75:72435- 73496
Transcript NameFunction/comments
g12286.t1KUF78443.1 hypothetical protein AM587_10012910 [Phytophthora nicotianae

Sequence
1061 bases(100 bases per row)
ATCGATACTAATTATGTTTGATATGTGCTTGCAGATTACAGGAGAGGCACCGAAAAGACTCAAGCAGCTTTCCCAGGATGCGCATGCAATTGGTTCGACG
GGTGAATTCGACAGCTTGGTGGAGAGTCTTGATGCGCTCTATAGCTTCACGGATGATCGCATGGCCCTTTGCCCAACGGTGTCAGGATCGCAGCCATTGT
TACGAGAGCAAGACGTCAAGTACAACGATCTCACTGGGATGTTCATAGAGTTCATGCAAAGCAAGCTCGTTCCGTTCGACTTGGACGCAGTCAACCGAGC
AAACTGGAGGCATACCAGTGAACCCGGCATCAAGTTCAACTCATATTTTGAGGAGGTACGTATTACCTGTTACCGCTGGTATAGTTCTGGAAGATTAACT
CGTTGTGCTGTTTAGCAGTCTGCTGAAACAACGCAGAACATGGTCTTACGAAAGTTCGGTGTCGAGATCAAGCAAGACGAACGCATAGCTAAGATGGCTG
GAAAGCAAGCGATTCGTCGGTACGTCGAAGGCGATCGAATAGTGATCGTGCGGAACTCGGTTATCGATCGAGTGGAATTATCCGGTGCGGCTACAGGAAG
CCTGGCGTTCCGAGACTCTGGCTGGATAGTGATGAAAGACGTGACAGGTCTCGTCTCGGCGTCTGGGCCGATGACGCTGGTCCAGTCGTACTCGGCGTTA
ACCCCCGACGTTGACTTGGATGCGCAATGGGAGGTCGGCGCGTTGACGGACTTTGTGCTGCAGTCGCGCGAAGACATTGAAATAGGCAACGAAAGTATTG
TAGAGAACTTACTGCTTGAAGAAGTCTTCAAGCGAGCAACTTCATGAAAATGTAACTGTCTTTCGCATTTTCGCTGGACAGGTCAGTATATGCATTGTAA
TTTATTGCGGACAATTGAGGTCAAAACAATGGTGATAATAACACAAACACATGTACCACTTCATTTGCAGTTTGCAGTTTCGGGCGGAGCCAAGAAGCCG
GTCTTGAACGGGATAGGCAAACTCCATGTGGGCTTTGTCACGATTTACAGATTAGCCTGAT