Description :
From Genome Similarity Track
Location :
scaffold_798:7242- 10356
Sequence
3114 bases(100 bases per row)
ATGCGGTGCTCCGTCGGGAGAAGCTTGTTGCGGCTTGTCTGGAAGGATCTTGACGCGGTCTGCGTCTGAGCGGCACGAATTTCATTGCATGCGAGCAGAC
TTGCGCTGATCCAGAATTTCCATCTGATCTTCCAACATGTACGCTTATCCGGAACGATTGCGGTGGGAAGAATCCATAATGATCCAATGACAGCACTTGG
TGGGAAAGGTCTACAATCCTGACTCATCCAGGAGGGACTCTCGCACCTCTTGGTTGGTCCACTTGTTGATTAGCCGCTTGTACGCCTTCTGTACATGATC
GTACTAGGTCTTTCGTGTCTTTGCGAGATTGCTCGAGTAGTCATCCAAGGTTTGGTCAATGAAACCAAGTGACCGATTCACCAGAAAGCTCGACGGTTCA
CCGACATGAACTCTACCAGCTCATCCAAAGGGTCCGAGAGATTTTCGAGAGCTGAGTCCGCGTGTGGAGCATGAGATGCTTGGTGCGGTCCTGAAATATT
CGGCCCCATGGCTTGGTCTCCCACAGCGCGATCAAGTCCGCTGGTTTCCAACGGAGTTGATTTGTTTGGCTTCCTCCGGCTTGGGAGCGTAAGATGGTAA
TCCATATGACCTCTCCAGAACGTTCGTGGTCCCGGGGGCGTACTAGACCAGGATGCCGTAGTGTCTCTACGAGTTCACCCCCGAACTCGGAGTCTCTATC
TAACCAATGTTTCATCAGGAGTAACTCCTTGGTAGTTTTCCGGGCGAGCAGGACTATTTGCGTTCCCGAGCCTGACAAGACTCCCGTGAAGGGGGCTGCT
GAGGCGTCTTGGACGTTTCACTGGACTTCTTAGGCATGCTTGCAGGTCCTGAAGACGAATCCACACTCAAACTACGATTGGCTTCGCGAGGAGTAGTGCG
CCGATGCGACACTGGTACCACCTCTTTCGGGGTAAACGAGTCGTCGTTAGCCTCATCGTCTCCTACCTCGTCGTCAATTCGGACTTGCTTCGTCAGGGAA
GTCCAACTGCTGGATGTTCCCGGGTTCCAAATCTGCCTCCAAACGTGACTCAACGTTCTTGTAATACCAACTCGGTACGAGCTTCGTCTAGGGAGTAAAT
CCAGGAGTTTCCAAGACATCCCCCGGGAGAGCATAGCTGAGAGGAGTCGAGAAGGAATCCGAGAGTGCGCCTCTTGTCGCTCTGGATCAACTCCTCCGCT
TGGGCCAACATCAACCCGGAGCGTATTAGAGTCTGCACATCGTGCGAAGTTTGTCCCAAACCACCAGACCATCGAGAGACGCACACACCGCGTTAACGCC
CATGAGCGAGGACACGGTCGTGTCCAGGGCAGACTCATCACTTGGAGTGTACGTCGAGGGCGCCACTGGATGTCCCGAGACGTCGATACCTTGTCCGAAG
TCTTGGACTTCTCTGGAGGTGATGATGAAGATGGAGTTGAAGAATCCTTTGAGAAATCCAAAGGGTCGTCCTTCGACCCATCGTGAATTCCTGGGCCCTT
TGAATCCGCCGAACCCTTCGAATCTCCAGGGTCTTCTTTCGCCTCCGAATCGACATCTGCGAACACGTACGGCTCCGACCGCAGCGTAGTGTCATTCAAG
GTGTTGACGAAGATCTGTGTCTTCCACGTTTCTGAAGGCTCTTGACGATCATGGAATTTTTCGAGAAGCGCTTTTAGGCGCGGCCAATTGCCATCCACCC
GAGTTCTGTGACGGTTGAAGAAGTTCATCAACGTGGGCGGGTTCAGTGTCACCGCCTTGAGGCGGTTCTCCATGCTCACGACAAGCTTACTGTATTTCGT
CGTTTTCACTCTTCAAGGTGGAGATCTGCGCTTGAAGAGCGCGCTCCTAACGCTCGTGCTCCCGAACCTCGGGTAATCCTGAGCATGCTGACCCAGTTCT
TCGTAGATGTCTTCGGCTACTTGACACTAGTACTCCCTGTGAAGACAGTAGTCGGTCGAACGTGACGTGCTTCGTTGTGAGACGCCAGATCCCGCAGTGT
CGCTTGATGACCGGGGATGTTGCCCAAGGCTTCCAGAGCGCGGTACTTGTCCAGAATGCGCTTCAGCAAGGTCGTCAATTCGAAGACCTTGTGCGCCAGA
TCATCAGCGCTGTAGTGACGGAGGAGGGACGTCATTTCACGCTTGGTAGCGATGCTCTTCAGAGATACCAGGAAGTCGCTCGGGTCACCTTCAACGGACA
CAGCCAGAGGGGTCAAAATCTCCCTCCGAATGTCGACATCTGGGCGCAACATTTTCGCGGATTCCTAGATGTCGAGCTCTGAGAACGACTCCACCATTAA
GAGGCACTCAAAACCGCCGTACCTACCGCGAATTAGACTCCCACTCGTCAGGCCCGTTGCAGTCGCTGGGACTCCGACGTGCATTATCTTGGGAGTGGCC
TGACGCGGCAGTGGTGGGGCGATACAAGCTGGGGTGTCTGTCCTTTCAGGATAGGACGATCCTGTACCGCAACGCCAAAGTTATCTAATTCCGCCCTCGA
GAACACCTTGTTCAGCGATGGCCGGAGAGTGCGCCGGGTGAGGTCTTCAGCCGCCGGAATCTGGGAAGGAACAAGAGTTGAAGCTAAAACCAAGTCTGCA
GAGGAAACGTCACTTGAGGCGGTCGCTGTGCTCAAACCGGAGCAGCCCTTGCTGGAAGCGCGCTTCCTCTTGTTGCCAGGGCGCTCCTTGGAGCCGCTCC
TGCTTTGCTTGCCTTTCAAGCGCGCCGTGCTGGAGCTCCAATTCTTGTGCTTGCTTGAAGAACGCGCCGCGCTGGAGCTTCGCTCTTGGGAGCGTCTTTT
TTGGCTTCTGCCGTCTTGTTCTTGTCCACCATCTGGTTTTCGGGCGGGGTTGCGTCGGTTTTCTTGTTTTTGAGAGTGGTGCTGGATCCGCCGTCTCTAA
CGCTGTCGTTTTCGATTCTGGAACCTGTTTGTCACTGGTTCCTGGCGTCTTATTCACTGCCGCGTCATGAGTTGCCTCCGGAGCTTGCTCTTGAGCCGTT
TCACCGCGCTTGACAGTCGAAGAAGCCGAGCCTGGACCGGGAGTTGCACCAAGTGCGCGTCGGGAAGTTGTGCTGGTCCTGGGGGAGGCGAGCCGCTAGT
TGGTGCCCGGTCGC