Description :
From Genome Similarity Track
Location :
Scaffold_193:7240- 8242
Sequence
1002 bases(100 bases per row)
ACACCTTCATCTCTCTTCAACGCCAATGTCCGTTTGGGTAGTGGCACGATGATGACACTGCCACCACAATAGCATATCGAGATAGACGTGATCGAAGTGG
CAGAAAGGAAACACTTTCAAGTCTAGTACAGCAATTTTATACTGGGAGGTAGGTAAACTAACGACAACTAATCGAATCCTAGTGGATGTCCATCGTGTTG
AGACCACCATCTCTCAACACGATGGACATCCACCAGGTAGACAGGGGTCCACCAATGCGATACCGATCAATGTGATAAACGCGACCCGATCGTTGTGTCA
AAGCCACTGGCGGTTGCAATAAAAGGTCGTAGTATGCACTGGGGCTGTTTCGTGCAGCGTATGAAAACGCATGAAAGTGTACGAAAGTACTTTCGTGCAT
CAAAAACTGAGCCATTCCCTTAATAAAATGTTTTTAAATCTGCATGAAAGTACTTTCGTGCACTTTCAGGCGCTGCGCGAAACAGGCATACTATGCACAT
GGCGCTGTTGAagtttcttcttgttcactTTCCGACATAAAATATAGGTCTGCATTGGCAATGCTGGAAGCGCGATTCGGGAGAATTACGGATTGATTTC
ATGTGAGAGCACCCCGAGCCTGCTTTATAGTCGTAGTGTATGGGTGTAGAACGGCCCGCACAAATgccgtgagcttcttcctgTCAGAAGCAGTTGCTAC
GGATCGTGTTCGTTCCAAAGCGCTCGTTGCAGCGTCTTATGACGCGGGTGCTAAAGTGTAAGTATGTGTCGTTCCCGGACCCTGCGACGTCGGTGGCTTG
TTAACTGTAATTGTAAGAAGAAGGAATTGGCGAGGATGTGGGTGTTGCGGCTGAAAACGGGCAATTCGATCTTGTCAGGCTGCTTCTTTCGAGCTGCAAG
CGTGAGAGATGTGGCCTTGATTTGTGGAAGCAGCAAGAGTGGAAATTGAGGCCTGGGATGGCCAAATTAGCCGCAATAACGAGTAAAAGCTGCTTGGTAC
GA