Description :
From Genome Similarity Track
Location :
contig_34:72392- 77825
Transcript NameFunction/comments
g7752.t1hypothetical protein
g7753.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
g7754.t1hypothetical protein

Sequence
5433 bases(100 bases per row)
TACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAATCAGCGACTGCCACGTGGATGCC
CATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGT
CAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAACACTCCCACT
CGACTCGACAGCGATTGCACCTTGGATCCCGAGCTTGGTCCGGAGCACACTGAACTGCACTGCAGTGATCGCCTTCGTCATCATGTCCGCCAGCATGTCC
GTTGTCGACACATACTGCAGCACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCGAATGTCGATGTGCTTGGTGCGCTTGTGGAACTGCG
GGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGACCGCTTCATCGCTTGCCATCTCGCCGAGCTCACACAGGAACACCTTGAGCCA
CACTGCCTCTTGTGTCGCCTCCGATAGCGCCATGTACTCTGCTTCCGTCGAAGACAGCGCCACCGTCCGCTGCTTCTTGCTCCTCCAGCTGATGCATCCG
CCGTTCATCATGAACGCGTAGCCGCTTGTGCTCCGTCTTGACTCGATGTCGCCGGCCCAGTCCGCATCCGAATATCCGCACATACCAAGGCTGTTCTTCC
CGTGAGAACTCGAGTCCATGCGTAGGCGTCGCTTGGAGGTACCGCAGCACACGCTTGAGGGCTTGCCAATGCGTCGGACACGGGTCGGCAGAGAACTGGC
TCAGCACTCCCACTGCAGCAGCCAGGTCCGGACGCGTTGCCACCATCAAGTACATGAGAGCACCGACGGCACTCCGATACGGCACGTTCTTCATCGTGTC
TTCATGCTGGCAGCCACCCTCACACATGTTCTTGGTCAGCTTGAGTCCGGGTCTTGCGGCGTCTTCACAGGCTTGCTGTCTTGCATGCCGAACTTGGTCA
GGATGGACTTGAGAAACTTGGTCTGCCGCACCGTCACTTTTCCGGAGTCGCGGTCGTTCTTGATCTCCATCCCGAGGAAGTACTCCAGCTCGCCGAGGTC
CGTCATCTCAAACCGCTTGCTCAACGCGTGCTTGGTCGATTCCAACAGCTCGTCGTTGCTGCTAGCGAGGACCAAGTCGTCAACGTAGAGCGCCACGAAG
ATCATGTCTTGGCCGTCACGCTTCAGGTAGACGCAGTGGTCGGACTCGCACTTCTTGAACCCCAGCTTGAGCATGAAGTCGTCGATGGTCTGGTTCCACA
TGCGCGGCGACTGCTTCAGTCCGTACAGCGACCGCTTGAGCTTGCACACGTGGTCCGGGTGGTCTTCGTCCACATAGCCATCCGGCTGTGCCATGTAGAT
GTCTTCGTCCAGCACACCGTTGAGGAACGCAGTCTTGACATCCATCTGGTGCAGCTTGAGACCATACTTGGCAGCCAGACTCAGTACGATCCGGATCGAC
GTGAACTTGGCCACTGGTGCGAAGGTCTCGTCGTAGTCGATGCCGTACTTCTGCGAAAACCCCTTGGCCACCAGTCGCGCCTGAACCGCTCAATCTCTCC
AGCTTGGTTCTCACGCGAAACACCCATCTGCAGCCGATCGCCTTGCGTCCCTTCGGTGGTACGACATCCCACGTGTCGTTCTTGAGCAGCGAGTCACACT
CCGAGTCGCACGCCTCCTTCCACTTGACTGCGTCGCTGGATTCCATCGCCGACTTGAACGTGGTCGGCATTTCTCCCACTGAATCCACGACGTACGCAGC
TTCGAAGTCTTGACTTTCTTGAGCCGCAGCAGACATCTCGTCCAGCGTCTGGTGTCGACTCTGACGCATACCGCTTGGCACTTGGAACCTCCGTGACTTC
CTCCAGCGACTGCGTCCGCGGGTGTCGCTTGTTGCCGGGCCCGAAGTCTTCGTCCCGCGCAGCTTCTTCTTCTTCCTCTTCTTCGTTGTCGTCTTCATCC
GACTGCGACGAATCTTGATCCGTCGTCTCTTCATCTTGAATGACCACCACCTCCCTCTGGTGGTAGTCGCGTCTCCCACTGTCGAAGACGTCTTCCATGA
ACTGCGCGTCGCGACTCACCAGCACGCGACTGCTCTCCAGTTCTTCGAATCGATACGCTTTCTCGTGCTCCGAGTACCCAGGAACCGACAGCGCACCGAC
CGAGCGTCGAACTTGGTGCGCTTCGCCTTCGGCACGTGCACATACGCGTGGCAACCGAACACTTTCAGGTTCGCCAGCAGTGGCTTCTTGCCAGTCCAAA
CTTGGTGCGGAGACTTGTCGTGGCTGACGGCGCGCGTCGGACACCGATTACGGAGGAACGTAGCCGTCATCACCGCTTCACCCCAATACGTCTTGGGCAA
TCCGGCATGTTCCAGCATGCAGCGCGCACACTCCACCAACGTCCGGTTCATCCGCTCGGCCACTCCGTTCAGCTGAGGCGTGTACGGCGGAGTGAACTTT
TTGCACGATACCGCGGTCCGCACAGAACTTGGCCATCGCGCCGGAAGTGTACTCGCCACCGTTGTCGCTCCGGAGTGTCTGCACGCACTTGCCGGTCTGA
GTTTCAGCAAACGGCCCAATCTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAGTACACGACGCAGAAGTGCGACTTGTCGTCGATGAACG
TGACGAAGTAGCGCTTGCCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACATCACTGTGAACCACCTCCAGCACGTGCTTGGCACGGTTCGGGGACGA
CTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTC
TTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCAAATCCTTCGAACTTGCCGCA
TTGGCCTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGC
ACCCGTCGCTCTCGAAGGTCACTGGCCCCACGTCCTTGGTGAAGCGGCCGACCGAAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAG
CACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACC
GGAGCCATCTTCTTGTAGTTCCTCATGTACTTGTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTCGGCTTGGCGGTGC
TGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTCTGGAC
CCGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCCCCGGTCTTCTTCACCGGACGTCCTTTGCGCTTGTTGTCTCTCGTC
ATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAGTT
CCCACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAAGTCGTCCTCGCT
GACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGTCGTGAAGAAA
CGCCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCTTGACCATGCATCATGCGCGTCCTTGGCCGAGCGAACCAGCG
GCAGCTGCGAGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTGCAGTGCTCCAG
CTTCACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCCGTTGAACTTGTTG
ATGCGGGCGGTCGTGGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGGCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGCTTTGGT
CGGTTGATGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTACTGGATACACTCTACTGG
ATTCCTTACCGGATACTGAGTTGCTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGT
AGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGT
ATCCTACCGGTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAACAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCACGAGA
AAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCTTCGACAGTGGGAGACGCGACTACCA
TCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGACGACAACGAAGAAGAGGAAGAAGAAGAAGCTGCG
CGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAGGAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGA
GTCGACACCAGACTCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGATTCAGTGGGAGAAATGCCGACCAC
GTTCAAGTCGGCCATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTA
CCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGG
CCAAGGGGTTTTCGCAGAAGTACGGCATCGACT