Description :
From Genome Similarity Track
Location :
Scaffold_79:7239- 8280
Transcript NameFunction/comments
Physo_139822reverse transcriptase

Sequence
1041 bases(100 bases per row)
CCAGTAATGAACTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCGTTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATG
AAGAACTGAGGCAGCTCTTTATGGAGACCACCACTGAGCGTGAGGACACTCTCAGTGCGAAGACTAAGAAGGAGCGCTTTGAGGAGCAGAGCTGGGACTC
GCTGAAGTCGAGTCCCTTCTACGAGATTCTACGGAAGCACGCGGACGTGCTTCCGGAAGAGACCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCAC
GAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTC
GCAAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAA
CAAGTTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGCCATCATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGAT
CTGCGCAATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCTGTGAGCACGCCAAGCAGCATGCTCTGGGAGTGGCTAGTGATGC
CGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGTGCTACTTCGACGATGTGTT
CGTCCACAGCCGGGCTGCGGACAGGATGAGTGATGTTGAGATGTACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCG
AACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTAA
TCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGG