Description :
From Genome Similarity Track
Location :
Scaffold_3:72381- 75021
Transcript NameFunction/comments
Physo_127810hypothetical protein
Physo_108214predicted protein

Sequence
2640 bases(100 bases per row)
AACTTAAAAGTTCATGCGCAGGTAACTTGCTACGGTGGTCATTTTTATTAGATTCGCGTCTTGGTGATCAGGACCTTTGATCGTACCGTATTTCACGCTT
ACAGGGTTTTAGAATATGCTTACGTCTTCACTGTCTTCACTGTAGCTATGTGAGGAGAGCAAGCTTGCGTAATTTTTTTAAATTTACGGAAAAAAGACAA
ATTAACCTACTTACTTAGGTTCCTCCCTTGTGAGTTCTAGGCTAGTAATGATGGGTATGCTTGCTTACTGCGGCTAGCAGACAATACACCACAACTACGG
TAGACGCAACTAGTACACCACAATTAGCCTTTCCTACGAACTGCGACCCTCCCCCCTGGAGGCATCACCGGGGCCATACCGGTGTGATAGGTATCCTACC
GGTTCAGTCTGCCCAACCTTTTGGAGGGCCCAGTGCAGCACCGTAGTCGTACTGGTTTCAAGAAAATATATCAAGAGGGGCATCGTTTGACTTGACATAC
CACGGATATAATCCTATTTGGTGTGCGATAGCAGCACTAACGTTGCTTCCTATCCCAGTATAAACCAACATTTTCAGTCATGTGAGTATCCATCAGAACT
TAGTGTCCGAGCGATAGATGTATTCGGACAAGAACTTTTAGTGAATCTCTCCTCATTTCCCAAAGTAGGGTCATCCAAGTTCCCTGCCCTTTTAAGAAAT
GGCCGCGCAGCTCAAGCGAGATCGCAAACGCCGAGAGCGAGAGACGAAAGAATACGAAGCTCAACGGCAACGATATTGCGACCAGCCAACATTGGCCGTG
TCGGGCAGAGCTGCCTTTTGCATGCGAGATATCGACCTGCCTGCAGCGAGTGACACGAGCGGACATTGTACGGGGTTTGCCGTCTCGACCCAGGGCTTCT
TTCTCACGGCCATCAGTGTCTCCGAAGCTCAGCACTGACAAATGTCTGGCAGAAGACGACGCATCAAATGCTACGTGGAGCAAGTCAAGGACTTCGATGA
GTACGGCGTGACTCTGATGAAGCAGGAGCGAGGCGTGCCGCTGGCGCGATGCCTGATACCGGAAACTGACCTGGAAGACGGCCAACAGGTCGTGGTGGCT
GGGATAGGCATGATCGAGAGATTCCAGCAAACGGTGCCGCTGGGGTTACGCGCTCAGATTGACTCTATCAGCGGCGGAGTAGTCAAGGTCGACAACATCT
ACGACTGCACCGCCGGTGGACCGATCCTAAACCCGACCTCCAACCGCTTTGTCGGCATGATCACGTCCATCGAAAAGGACTCGTGGCTGAAGAGCGGCCG
GGCCTCATTCTGCCCACTGACGCTGAGCTCGCCGTTATGGATCAAGATCGGCCAGGCCATGCAGCGCTATCTAGCCGAGCGTCTTAGACACCTGCCGGTC
CAAACGCTGTGAACAAGGGACCAAAAAGCACCCCAATAGCATCGATTTATCACTTCAACATGATCCCTCTCCTATTCGATATGGCTACAGCTAATCATCT
TCGTCGCATTTGATCACATCGTAATTGGCCGTAGCGATGCCTGTCCACGCGCGCGACGAGGCCGCGAGCTCGGACGACGATGGCCCGATGCCGATGCCGA
TGCCCATGCCGGCCCAGCCGGCGAGGAAGAAGCACAAGAAGCTGCCGTTCGAGGCCGCGTACCTGCGCAACCTGCCGAGCGCGGCCATGTACGAGCGCAG
CTTCATGCACCGGGCCGCGGTCTCGCACGTGCTAGTGGCCCCGGAGACGCAGTTCGTGATCACGGCCAGCGTGGACGGCCACGTCAAGTTCTGGAAGAAG
ATGGCCAAGGGCATCGAGTTCGTCAAGCACTACAAGGCCCACCTCAAGGAGGTGCACGGCCTGGCCGTGTCGGCCGACGGCCTGCGCCTCTGCAGCACGT
CGGCGGACCGCAGCATTAAGTTCTACGACGTGCTGGCCTTCGACATGGTCAACATGCTGAGCGTGGCCTTCACGCCGGCCGAGTGCGGCTGGATCTCGGC
CAAAGGGGCCATCGAGCCGAAGGTCGTAGTGGCCGACAAGAACAGCCCGGCCCTGAGGATCTACACGGCCGAGAGCGCGGCCAGCGAACCCGTGCACACT
ATCAGCCAGTTACATGCGGCCCCAGTCACGGTGTTGGCCTTCAACCCAGTGGCCAACTGCGTCATCTCGGCCGACCAGAAGGGGATCATTGAGTACTGGG
ACGCGGACACGTACAAGTTCCCGAAGGACAAGTCGTTGGCCAAGTTCAAGTTTAAGGGAGAGACGGACCTATACGAACTGGCCAAATGCAAAACGTACGC
CACGGCCATTGACGTCTCGGCCGACGGCAAGAGCTTCGTCGTGACGGCCAAGGACAACCAGATTAGGGTCTTCAGGTTCGCCACAGGGAAGATGCGGCGC
AAGTACGACGAGAGTCTTCCGGTGTTCGAGGACGCCCAAGCTGACGGAACGCTGCACCTCGACGCTTTGGACTTTGGCCGACGTGCCGCCGTGGAGCGAG
AGCTGGCCAACTCGGACGTGGTCTCCAATTGCGTGTTCGACGAGTCAGGCCATTTCATCTTGTACCCTACGCTGGCTGGTATCAAGGTGTTGAACATCGA
GACGAACAAGGTTGTGAAGGTGCTGGGTAAGGTAGAAAGC