Description :
From Genome Similarity Track
Location :
Scaffold_7:723801- 729612
Sequence
5811 bases(100 bases per row)
TGATGGTTCTTTCGAGCATACTTCTCCTTGTTCTTCAACTTGAAGCACTGCTCAATGACATGACCAGACTTCTTGCAATAAGGACATCGCTTGTTAGACG
ACGAAAAAGAAGCAGAACGGCGATTCCGAGTACTCCCTGAGTCAGTTTCCATTGGCTCGGGTTCGTTCTCCTGAACACGCATAGGCGTGGCTTGCTTTTG
GTGCGAATTGTTGTTGGACTGAGAGCGTGATCGGTCCTGCAAAAAGAACGGTGGACGATAGTTCTTATCGCGGACATGATGCGATCGATCATACTCCAAA
GCAATCTTCATTGCTTGCGACACTGTTGTACAGCGACGATATTGCACCTCTTCGCGCATAGGACTCTAGCCCACGTGTGAAGTAAGTGATCTTGTCCAAC
TCACTCATGTCTGTCACTTGCATGATGGCTTCACGGAAGCGAGAGATGTAATCTTCCAAGCTAGAGCAATTTTTCCGCTTGAGCGCGTACAATTGATCAC
GCAAACGCTCTTGCCAATCCGGAGGCACAAATTCATCGGTCAACCGGGTCATAAGGTCCTGCATGTCCTTGATATCACGCTTGCTCAGCTTGTACCAAGC
GGCAGCATTTCCTTTAAAGTTCGCAGTAGTAATGGCCAAAATTCGAGAACTTTGGTTGTCGTTTTTCCAATCGATGTTTTTGGCATCAAAGTACTGAGCA
AGTTGCTCAAAGTACAAATCAACAGATTCTCCCATCTTGCCATGAAATTCAGGCAGACGGCTACCTTCCACTTTCACTTCCCGCTTACTCATGGCTTCAA
GCAGTTGTCGCTGCTTGTCAACCATTTCGATGAGTTTCTGCGTGATAGCGTCAGTAGACCCTCCTTGAGGATTCAAGGAAGTCATGGTTGATTGTCGAAA
TATTTAGCGATGAAGTGCCGAAAAGGTAGTCGGGTACAGGTGGACGGCGACGAGGGGTGCAGGTACTGAATTGATCCGGTTCTTATAGACCAGACACTTA
CAGTACACACGCAATCAACGATAACGCTGATGAAGGATGCGACGTTGGGTACGGGTACTAACTTGATCCGGTTCTTATAGACCAGACGCTTAGTGCAGTA
CACACGCAAAATTTCAACACGGCAAGCCGTATGAAATGAGGTCGCAACGAAGAAATTCGACGAATGTGAAGGCGAAGAACGACGACACACGCTCAACGAG
CGGCTTTCCACGTGTCGCGTAGCGAATAGAGAAAGAAGAACCCCCTCCCGGACGAAAAACAACAAGTGCTACCAGATGTGACGACTGGTGAGAGCACGGC
GCAGAGGAACAGCGACGAGAAACGAGTCGCGTGGCGAGGAGCGAAGCGGAGGAGGGCGGCGAGAGTCCAACGATGGGGACTCGAAGGTAAGGCGTAGGAG
GCAGTTGATGTGCCTCGAAGAAGGTAAATTGGAAAGTCAGATTGAAATGGTTAGTTGTTTGTCGGCTACGAGGAAGTGCTTGTTGGCATTCCCTTGGTAT
CCTATGTAAGTATATGCATTTCACTATACTAGATTCTAAGTAGTCCTTGAGTCGAATCTTGAAGTAGCGTAGCGTAGTAGTGAACCGCGGTTCATTTGAA
CCGGGTCAGAATCTCCATAGTGAATTCAAATGAAAAATAATGACTGTCATTGAAGTTCCATGTTTGGCAATACTCGTCCAAACATGGTGATTGCCTTTTG
GTCAGGCGTGTGTCTGCCTGGCCGCTCATTGGCAACTTAAGAAGACAGTTGGCAGTCAGCAAAGACAAGTAGGAAGAAAATAGAAGAAAGTAGGACGCAT
TGGTACCAACGTCATGGCCATCGCTGGCTGTGACGTTGGTGCGTCGTTACGTCCTCCCGGACTTGACTTCTCGTTGACGCTTGTTGAAGTCGGAAACGAG
AACCTTCCAATGCGACACATGGCAGATGTCTTTTTCGCGCTCCCAGGTTGCTTCGTGATCTGGCCATCCGTGCCATTTCACAAAACTGGACGCAAGAAAC
GGAATCCGTTGAATCCTTTGAGCAATCCCAGTACCATGACTCAAATTCAGCGTGGAATTGTTGAATATGCGAAACAGTTCCAATACAAACGCCAAGAGAT
CATTGATTTGGCAAAGAAGCATCTTCTTCAAGCCCAAGAACGTCAGAAGAAATACTATGACAAGAAGCGACCATCGATCACGTTCAAGGAAGGAGACTTA
GTCATGCTGGATACACGCCGCATTCCTTCCGCCCATGTGACTCAAGACATTGATGGGAAGCGAGCTAAGCTCGCTGCTCGCGAGATTGGACCATTCGAGA
TTGTGAAAATGATCAACCCGAATGTGGCCAAGTTGAATCTTCCGCGAAGCATGAGTCGTCTGAACTCCACGTTCAATGTGGACGTGTTGAGTCATTACGT
TGAAAACCCGTCGCGTTTTAAGACTCGTCCTATCCCAAAGGCCTCAAGACTGATTATTGACGACGACACTGGCGCAACGATGCACATCATTGAGAAGCTT
CTTCGCAAGCGTCAATTCAATCGCAAACCTGAATGGGTGTTCCGTTTACTCGGGACAATCACCTTCGAACTTCCATCATCTCTTGCTTCCATGACTCCAA
TATTGCTGCTCATCCTGGAGCTCATCGAACATACCTTCGCATTTCGCAATGGTATCATTGGCCCACCTTGGACCAAGACGTTCGCGATTATGTGCAAAGT
TGTGAAACTTGCACTCGCTGGAAACACAGCAATGCTCGCAAGAATGGCAAGATGATTCCCATTCCGATTCCTGAGAAATGCTGGTCTGTCGTCTCTATGG
ACTTTATCACTGGATCACCTGATTCCAATGGTTTTGATGCAATCTTGACTGTTGTCGACAAGTTGTCCAAGCGCCCGAAGTATCGTGCGTGCAACCGGAC
TGATGATGCACAGAAGACTGCGTATCACTTCTTTGATTGCGTTGTTCGCCATCACGGTTTACCATCGATCATCATCAGCGATCGAGATTCCGAGTTCGTC
TCCAAGTTCTGGTCATCCTTGGCTAAGCTAATGGGAATTCGTCTGCACATGACAACTTTCTATCGTGCCCAAGCCGATGGACAAACCGAACGCCAGAATC
TGATTCTGGAAGACGCTCTACGCTGCATGATATCGCACCACGGACGTGATTGGTCGGATAATCTCGGAACGATTGAGTATGCTCATGCTACTCTCGTCAG
CACATCTACCGGTATGTCGCCCTTTGAAGCTGATACGGTGTAGCCGCCGGAGACATCGCAGATGGAGTAGACGGCTTGTCGGCAGCTTCTTCCCCACCCA
GAGTGGAGACACACGGCGCTGTGGGATTGCCCACGGCGAGGAGAGCAGGAACACGCGGGTGTCGCGCGTTGTTAACGAAGAAGGGCGTCAGCCCAGTCGA
CGCGTGTACCGCGTTGTTCAGAGCGAACTCGGCTAGTGGCAGAAACGAGCTCCAGCTGGAGAACGACGTCGCGTAGCTTCGAAGGACGTCTTCGAGGACG
CGATTTACGCCCTCCGTCTGGCCGTCCGTTTCCAAATGGGCTGCTGTGGACATCATTAGCTTCGATCCCAGTAGAGGATCAGATCCTGCACGCACAGCAG
CGCGTTACGAGCCATAGCTGAGCGCAGACTCGACGCCGCCGGCAGTACCAACGTCTTTAGCACTTCATTGTCTCTATATCAACACTTACAGCGTCATCAA
AACACCTATTTTGCAGAGCCAAGAGCAGTTTTGTCACTTACAATTGACGTCGCTCGAAGAGCTTTGACGAGAAGGCCGACGTGAAGCGCGGGTCGCGGTC
GGAGACGATAGATTCGGGAAGGCCATGATGACGGAAGACGGCATCAAGGAAGTGCACCGCGGTATCTGCCGCGGTGATCGCATCCGACACCGGAATAAGG
TGGACCATCTTGCTGAAGCGGTCTACGAACACCAAGACACCTGAGCGTCCTTTAGCATCGGGAGGGAGCCCGAAGATGAAGTCCATCGACACAGAGCGCG
AGGCCTCGGTGGCCACTGGTAGAGGACGTAAGGGAGCCTGCGAAGCCGAGGACAAGGTTAAAAGCGCTGGCAAATATCGCAGGTGCGACAAACTTACGTA
CACGTATGGGAAGGATGGCGAATAAAAGTCGCGTGACACAGCGGCAAATGTCTTCTCGCGACCGAGATGAGCGCCCAGCGGGGCATCATGAAACTTATGG
ATAATCCGTGAGCGCAGATCGGGGTCGTTAGGGACAACAAAACGTGGGGCATCGAAGTTGTCGATGCTGTACGTCAGCAGCTCGTCCCTCGAGACGATAT
CGGTGGATTTTGTTTCGTACAGAGCGGGAAAAGGGCTCCCAGTGTGTCGGCGCTGGGAGAGCGGAGATGCTTCAGGATACTGGATCACGTCGAGCCATGT
TCGTAAGCAGCTCGGATCTTGTCGCGAAGTAGCATTACCGGGGTGACGCTCGTCAGGTTGACTCCTGTCGTCTCGCACATGGCACACTCGTCTACATCGT
CTTCATCCAGTGAAGCTTGTCGACCCAATGCACTGCGTGGGTCGTAGTCGGGACGCCGAGACAAAGCGTCGGCGAGAATGTTGTTCTTGCCGGGTTTGTA
GTGGACAACGAAGTTGTACTCAGAGAAGAACGAAAACCAGCGGGCCATCCGCTGGGAGAGATGAGGACTCTTCATCGCTGTCCTCAGCGATGCATGGTCG
GTATACACCGCGAAGGTATCCTCACCCAACAAGTACACTCTGAACTTGATCAGAGCGTAGCGCATCGCAAGGAGCTCCTTGTCGTGAACAGGGTAGTTGA
TCTCCGCCGGCTTCATCTGCCTGGACTGGTAGCTTGCGACACGCTCTCGACTTTCTTCATCGAATTGCATCAGCAGCACAGCCGATGGCGAAATCGCTCG
CGTCGCAGACGACGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN