Description :
From Genome Similarity Track
Location :
Scaffold_62:72375- 80269
Transcript NameFunction/comments
Hyaar_Emoy2807297hypothetical protein

Sequence
7894 bases(100 bases per row)
CCGAAACGGTCCATGTCACATATGAGCTAGCTTTCGAGCGTACCCATCTTTGACGCGATCCAAATTTAGCCACACTTGTGATCCGTGATCTATTTTCAGC
AGATTGTGGTCTTCGTTATGACGATCTGCTCAATATTGAATCGCGATCTTCAGCTGATCACTCATGGTCGATCTTGCTCGTTGATATTGGCACTGCATAC
CATACCGCCATCTTCTGGGATCGCGATTGCGAGGTTTGATGATCCCTAGTAGTAGGGTCGCTTGTTACGTCGATAGCGGGCCCCAGCTATGAATATAGTA
AAACGGTGTTTCTCCGCGGACTGGATCTTATGCGGTATTGGTCGCATAGGTTAATCGCTCTGTGTATTCTTCCCAAACTTTCTGGATTCATCATTGACGT
ACATTTTAACCGATCGTGTCAGTTTGAACCATGCGCTCTGCGGTTTCGTTCGCTTGAAGCCGATACGCCATATTAATCCGTTGCTTTTTTCCCGCGAGCT
CTTGAATGCCCGGAAAAATCGGACATAAATCCAGGTTCCCGGTCATGGCGGATCGCCTCACTTGCACCGAATTATCGAAATACACATTCTTCATAGTTTT
TTGCGATCGTCTGTGCAGTCCGGGACGATGTCGCCTTAGCGATCACATACCGAGAAAAGATCGACCCACAGCAACAACTATGTAATCCATTTGAAGGATC
TCGGCAGAGACGGGATGTGATCCATGGCCAGAATTTGAAATGAGTAAGTCGCTTGTAAGTTTCCCGGCGACCCACCCCGATCGTACGGGCGGACCTTGCC
GGTTTCATGATTTATGTACTCGCCTACATAGCGCTGTAAACTCCGGTACAATCGTCGCCAATTGAAGCTCATCCTAATCCGTTCATATGTGCCGCCTACT
CCTTGGTGTCCGCACTCTAAACTAGTATGGAAATGATATAAGACATCACGTTGCAATAATTGGGAATTACCAGACGAACCGACTCCCCACGATCTTAGCT
TCTTGCCGCTGCCCCAGGACAGAAAAATGACAATTCACTTTGGTCGACTTCATAGTCCAGTGCGATTAGGGCGCAAATCTCGCCTTTCCCGGATAAGATA
CGTCCTCAAGTCAGATATCCAACTCTCTTCATCTTGCACCTAATTTATGCGCTCATTCTGGACCTGTTGTACAGTCTCTTCTTGCAAAACGTTTGAAGAA
CAACGTCTATGCGTAGCTGACCGATTGATCGTGGCCACCTTGACTGGGAAATAGACATGTCACGGTATCAGCAACTCATTCAAACGATTAATCGTCATGA
AGTTGTTTCGTTCCTGATTCGATACATCGACATCACCTTTCTCTTGCTTTAAAGCTTTGCTTGCTAGACGATTATCACTCTGGTTCCAATCCCGCTTCAT
ACGTAGAAATTCATGCATTGGCCATGATCAAAGATTCGCCGTCGCCTTATGCCACAGTAATTGCAAACCTGGTGCCTTGCAATCGACCTCGCCCCGCATC
TGCCTGATAACTAAATTTGAGTCACCACAAATGACCACACGCCCACTAGTCTGATCACTCAGTGAATCCAAACTGAACAATAATCTACGGTATTCTGGTT
CAATTACTGTCAAATTCGGAATTCGCAGCCACGATCGTCCACTCAGGTAACTTCCACACTATCGCACTGTATGCGCCGCCCTCCTTCTTTACCCTTGCCG
ATCCGTCGAAACTGACCACCAGGAGGTTTTCGTCTACTTCGACCGTGTGTGGTGGCATGATTATAGTTTGCCGAGGCTGTTTTTTTGGAGCAATCGCGAT
CAGTACTTCGTCTATGTCTTTGCTGGGAGTCACACTTGCCACTAATATCCAGCATCTCGCCTTCGCCCATTTCACATCGTCGGATCTCTAACGTCCAGTT
TAATAGTAGCGCAGCCCATCTGCCTAATCTTATNNNNNNNNNNTTTGATCATGGCCAATGCATGAATTTCTACGTATGAAGCGGGATTGGAACCAGAGTG
ATAATCGTCTAGCAAGCAAAGCTTTAAAGCAANNNNNNNNNNAAGCCAGGGTCGAATATCTCGTAAGTACCATAATCTCTCTCAATACCAACATCGCATA
ACAAATATCTTATATTCGGAGGACAGCTAACATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTCGACCATTCCGTCA
TTGACTTCATTGGGCTTCAGCATGCGGCTGAAAAAGATGACTGGCCATTATAAATACCGTCGTATTCCTGGAGCAATGCCGCAGATATCGCCCACTTACT
GGCGTACACCACAATCACAGGCGATCGATCTGGATCGAAAGTTTCAAGATCGGTGTTTTTAGCAATTTTAGCCTTTAGCAGAGTAAAAACTATTTCCCCT
TTTTCATCGACTTCTGTTTTCGGATTCAGGATCGCCCCCAATGTTTCGATCAAGATCACCCCCAGTTCTGTTTCAGGATCGCCCCCAATATTTCGATCAA
GATCACCCCCAGTTCTGTTTCAGGATCGCCCCCTGTATTTTGGTCAGGATCGCGTTTGTACCCGTCTCGTGAATCTCGACCGCAATCGGGTTCGACATCT
GATATAGACAGCTGAATATCCTTATCACGGCTGATCTCATGAGACTCAGCTTCCCCCAGCTAATAGAACAGAGAGGTATATATCGAAAATTCTNNNATCA
AGCAACTGTAATAATTTAGGCTTCCCAAGAATGACTGCATCGATCGCAGAGTTCGAGAACAGGGAATATTCACAATTGGTCCTAAATCTTTGGGGTGGAC
TTCCATCCCCTCGAGCGAAACTTGATGACCTAGGAAGTCTACCTTGCTACGTCCCCGAAAGCTTTTGGTCACACTAATTTTAAAATGCACCGGTCACACA
CCTCTAACGATCGTTCCACTTTTTTATATAGGGAGGTGACTTAGCACGTATCAAGATGTCGTCGATATATGACCTCCAACCCAGAACCGATGGTTTTGGG
TCCTTATCTGGCTTTCCGTCAATAAAAAAAATGGGTTGGCATCGACGAAGTCGTTGTATTCGAGTTAGGCTTGTGGCAGATCTTCAGATATCCATATAGT
GCATCGTCGATCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAAAAATGTATCCGTAACTATT
CAAATAAACTCGAAGGCGTGATGAAAGCAGAAATGGNNNNNNNNNNATCTCCACCACCCAAAAAGCACTCTCCATATCCAAAGAACAATACCACATTGCT
TTATCTAAGTCCTGCAGCAATTCGCTAATCAGTGGCATGGGATATATCATCGATCTTGTAAAAAAAATTTACCTGCCTGTAATCATAATCGTCTGTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTGCAGCAATTCGCTAATCAGTGGCATGGGATATATCATCGATCTTGTAAAAAAAATTTACCTGCCTGTAATCATAATCGTCTGTCTTCCCCATT
CTTCTTGATGATCACCACGATAGGAGAAGCCCAAGGTGAGGTGACCTCACTTGGATGATATTGACCAATAGTAGCTCATTAATCAAATATGCTAGTTTTC
CTCGCTATTTGAGTGCCACCGGTCGTACTCTCTGCGCGATAGGTTTAGCACTTCCGACATCAATTATCGCATACCTCTCCACGTGCAGCCGGAGGCAGAT
CATTCCTCTTGCCTATGAGTAAATGGCGATTTTTCCAGATCAGTTGCTTTAACTTCTCTTGATCATCTGTCAGTGGTATACCCGGATCGCCAACTTGGAT
GTCTTCACTATCCACGTCTACGGTAATGACCACTTCCGGCAAGATCGCCATATATTGGTCCACGTCTTCGGCGAGAATGTTACCAGTGTCATGGAGATAT
AACGCAGTTTTCGTCGACATTTTGTCTGCTGGATCTTCTTCGATCGTGGGTGTTGTAGCGGTTTTATTCCCTTGATCTGACGGTTTTAGCTCCTGATTGC
CCTCATCCCAGCATTCATCCTCGATCGCAGCCACCTTCGCTTGTCCGACCACCCCATCCGACCGGTGCTGTGTTGGGTCGCCATTCCCTATACTCGGTAT
TGACTCGTATCTTGCGTTTTGTAGTATCTGCTACCCCTGGTTGTGACACGATCTTCCACATTTGGCTCACATCCATTTCCCTTTCACGTTTCTCTCTATG
CGTCAGAATCTTCTTGGGATAAGATACGACGGGTGGATCACTAGAGGCCCCGAATATTCGGTTGGACGCCCTTTCTAACTCCGTTGTAGCTTCGAATTCC
AGATTCTGCCATTCATCGTACGAAAGTAATCCGACCGAAACATAGCCTGGTGATCGAGGTATCATGTACGACATCATCCATTATCCTAGGGGCGTATCGT
GATCAAAAATCCCCTGTTGATCTATGATATTGGCTAACCGCAAATACCTAATCTGGCCGGGGCCAGTAGTTATCGTCAGTACCCACTTCTTGTCCCGTCT
TATCCATAGTTTGGATTTAGGGAAACCTGCTCCAATCTTCATTTCCGTGAATCCTCCGACTGGGATTACCACGTGTCGATCTGGGGCAGTTATCGCCTGT
ATATTTATCCATATGGAGGTCGTCACCCTGCCAGTTGCATTTATACTTCATCTGGTAATCAATGCGTAACGTCCGCTAGATCCATACGTATCTCTGCCGG
CACCGTAAAACCCATACCTAAGATCGCTTTCTTGGCCAACTTGATTGCGCACCCAAACATAAAAATATTATACTAGTGATCCGTTCAGCGTGACCTTTAT
CTTGGTGCGTCCTTCAGTCATGTAGGCGTTCTCCCCGATTCCTATACATTCTTGCTTCTGGCTGTCATCGATCATACACCCCACCTTACGATCAAAGCTA
GCATCGACGATTGAGACTTCGGCTCCAGAATCAGATAACTTTGTTGCCCTTTCGTTGTTGATTTTGTCAACCGCTTCAGCTTGTTTAAACCAATCTTCTG
GTGTGTGATATTTCAAATACCCCCGTGACTCTCCCGGCGCTAGATCTAGCTCCTTTATGGGGAGATCATGAATGTTCGTTCACTCTCTTCACACTTGAAA
CAGTACGCAAACGATAATTATCCAAATCACATGTATTAGCGATCAGGCCGATCCGACTGTTACTTCCCTGATCGATCCTTTTCGTTTCCACGAATGCATA
TATGCATAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAAACTGGCGAGCGTCCTAGCTTACATCTCTTTCGCCTTGGTCGGAAGTAGACTAGCATGCTT
GGTCGGCACGTACCACTTGCGGACAGGTTGTAGAACTCTTCCATGGGGCATTGTTTGCTCTCATGAGCCTCCCCACAGGCAGGACACACATGTAGGCATT
TGCCCGAGGGACGTTCTTTGTGGCCACACTTTTGACAGGTCAGTCGTTTCCAACATCCGCGATCATCATGTCTCTTCAAGCCGCAGTAGCGTGTAGGCTT
TCGAAAGTCCAGCACGATCGCGGTCATACTTCCGATAGGTCTTCTGCGATCTGTCTCGTCGCTTTCTCGGATCTGCGACTTGATTGTTGGTCGTCGTCAC
GAAGATCTTGTACCGAAACACTTCTGCATCCGATCCGTCTGAGCTTGAGACTGAGTCCCTTTCCTCACTTTTTACGCGAATGGCCATCACTGTGCGTGGT
GTTTTCGAATACACTATACCTATGATGAAGCCGATCGCGATCGTTTTTTGTTCGGTTAGGCCGAATCTTTATAATGTCGAAAGCTCATACGCTGATAAGC
ATGCAGAATTTCTTCCATCGTGTCAGCATCATTCACTCGCAATATTTTCAGTTGTTTCGCCAGCTCTCGATCGTACAAAGTATCAATGAAATGTTCTACA
TGTTCACGTCGGCATACTGGCGATACATCTCTGAACGCCACTCTAGCGCGCATCTCTGCCACATTTGGCCGGTGTAGATATTCCAACGGGGTCTCATTCG
ATCTCTTCCGCGCATGTGTATATTGTCTTCCTGCTGATATTCCATACCCTCCATATTGAAGCATGATGGTTACTGACAATGGCTTCCAAGAGCTACGGGT
AGATCGGCTCAAATGGTTTACCAATTTAGCGCAAGCCATGTGAGCAGATCTTCGAAGTCCAAACATTTTTCATCGTTGGAAACCTGATCCCGTAAGAAGA
CAGTCTTTATCTTGTTAAAAAAAAAAAACTCCCGACACGCTCTTCATCTTTTTCCTGCCCTGAAAATTCTTTCAGGTCCGTCATCGCCGACAATGTTATC
CTCTGCGCACTGAAGTCTCCAGTAGGTGCAGTCCCTGCGGTCGCCACCTGCGGTCGCCTTAGCTCGTTGAATCCCCGACAGTCTTATTCATGTTCGCCCG
ATCGATCGCGGTACAATTCAACTGATTCTATTACAACATCTTGGGCATATCGCTCTTGGGAATTCTTCATCCGTTCTTCTCGGGCCACCGGATAATCTCT
CCTTGTCCTTCGCGAACGCTAACGCACTTATCCATAGCGGCCCTGATGTACTTTTGTAGTTGACTTGGTCCCACCGTGTTTGTATTCATCGTGGCCGGTA
TTTGAGTCGATCGCACCCCGCTGTTGGCCGGTTCGAGACTTTCTCTCAGTAGCACTTCCCCAGTTGGTCCTAGCGACATCCGCTGCATTCCAAACGATTC
TTCTGAGTCCAATTCTGACTCTGCCGAGGCTTAACGCGATGACCCTATATAACCCTCTTTCGTAATGTGGTCGATCGGGTCCATCACTTTCCCCAGGTGT
TCCTCTTTCGGGATACGGTATATCTGCGTGAATCCTCTGTCTGTATTCTCCTCTTTCTTGATCTTTTGATCCGCATAATCGTGAGTGCCAGTTAGTGAAA
TTAGCTTCTCGAGTAGTATCTGCCTTGCCTTGATCACCCGATCGTGATTGCACTCTAAAGGTGTTTGTGCACCAAACGCTCCGGCTTTAAATCCGGTGTC
TTGTAGCAATTGGATAAGACAACGCGGTGCCTCCAACTTGTTAGAGGTCACCTTTGATGGTGATACCGGGCCATGTATCGACCCGATGAGTATGGGCTTC
AATACCTTAAGAAATTGGTCTTCCGCGAGCGTTTTCTTCAGTTGTTGCCAATGACTCTCCCATGTGATTAGTTCCAGCTGCCAGCCTTTTGATTACGTTT
CTTGACCTTCTGTCTTGATCGCTTGCTTGTTTTGATGTGGCTCCGCTGTATTCTTCTTCGATCGGGACAGCTTAGGAGTGTGTTACTTCGCCTATGGTTG
GGCGGTATTTTGGATGAACGTCTTTTAGTGTTCACTGAAGGGTTTTCATCTGGCAGACCATTTTTGTAACGCGATCTGCGAGGGTCCCCCCGAAGGCCTT
AGATGGGGTTAGATGTTTTACTTTCAGATTATCCTAAAAGATCTTCCTCTTTAACTTTCTTGTCATCATATTTTTCTTCCCATAACTATGATGATCTTGG
GATCTTTTCTCTTCGCACGTCTGCGGTGATACATCTTCTGCTGGCTCATCAATCCCCAGATTAAGTTTTAATTTTAGAATCTTCATCACGGGGCTCACGG
CCAAATCCCGAGTCACCATAAGATCCGTCCACACGCACCGTTGTGGTGGAGTGGGATTCACTCATTTAGGAGGTTATCCCAACTCTCCACTGGTGCCCTG
ACGACCGACTAACGGAGGGGGTACTCCGATTCTGCTTACACTTGCTCCTTCTTCACCTAGTGTAACCGTCGGTAGGGCGGATTCACTCTTCTAG