Description :
From Genome Similarity Track
Location :
contig_24:723709- 732766
Transcript NameFunction/comments
g4678.t1hypothetical protein F443_07975
g4679.t1ATP-dependent RNA helicase DBP9
g4680.t1kinesin-like protein
g4681.t1hypothetical protein PHYSODRAFT_508492

Sequence
9057 bases(100 bases per row)
CAGAAGCAGCAACGTGCGATGAAAGCCGGAAAAGGGAAGCAAACGAAACTCTTGCCACTGCACTATGAATCACCTGTACAAGTTAACCAGCCACCGTTTG
ACCAGCTCACGCATGAAAGCGAAGCTACGAGCACGTTTTCCTACGAGGCGTACGCTCGTCGCCCACCTCCACGATCACCCTCACTGAGAGCGTCCGCGTC
AGCGCCAGCTTTAATCCACGCCAAGTATTGTTCGCACAGTAAACCCGACCCAGCGACAATAGCAGCTGTAGCGAAACTCAAGAATGCCAAATTGCAGCAA
CGCCGAAAGGAAAAAGAGGCTGAAGGGTTAGCTCGACGAGCACGACAGCAAAGTACCGAAATCGCGCGCGCGTTCACCGCAAGTGTGGCAATGATATCGC
GCCATGTGCACAACGAGGAAGTGCGCGATCATCGTGAAAATGAGCTTGATACGCAAATTGCTCGCACCGATCAAACTCGTCAGTGGAACCAACTCCACAA
AGCGCACTGCCAGGCTATCGAGCAGGATACGCGTGAGCAACGAGCACGTGAGGTGTGTGCTATGAAGGCTTTGGCTGAAGAAGAGCTGCTCCTATCGCGC
GACTTCCGTGCGCTCCGCGAGGAGGTGGTGCGCCGCAACAAACCTCTTTTCGCGCTATCGTCCTCCACGACCACTATCTTCCCTGCGCCGCCAGAAATCC
TAGCTGCACGCGCCACAGCCAGCTCCTCGGCAGACCACAGACGTCTTGCCCGCGTGGAACGAGAACACGCCGAGCACATGCGCAGTCTGCAGCTACTGGA
CTATGCGTACGATCGCAAGCGTATCCTGGCCGCCGCACTGCAGCCCCGCGCCAATTCCGCTTTGGTAGAGGTAGACGTGCCCGACGAAGAACTACCAGCA
GACCGTCTTGTGCAGCTCGCAGGTGATGAGTTGTGGCGACAGATCCAGCAGCAACTTGATGGAGACCCTGACAACATTGCGCTGTTCGTACCACCCAGCA
ACTCACCGCCAGCAGCTCTTCGTTACTTCGGCACGAGTCGACCCATTTCGCTGCCGGCATTCGCATCAGCTGTCGATCGTAACCTTCAGTAGCGAAGCAC
AAGACGAAAGAGCACCACGAGCGAAGCAGAAAACGTGTATCTATTTGAAAGCAAAGCAGGAACAAGGCTCCGTGATAGGTAACAGTGCTGACACGGATCC
AAGTTCCAGCTCCTTAATGAGTAGCGCCCTTGCTCATCTTGAATTTCTTCTTGGCAATCGTTTTCGGGTTGAAGTGGCCCTTGCGGTGCTGCTTCTTCCA
CTGCTGACGACCGGCAGTACTCTTACCCACGCCGCTGTTACCATAGCTGATACGATCCTCCACAGTCTGCTTCTTGTCATTATCAGCGTCAGGGGCCACG
AACGTGTGCAACGGGTCGTTGTCCGTACGGCGCTTGCCGTCGGCAATGCGTTGCCGCTTGTTGTGTTTCTTCTTGGTGCGTGCTGGTGCCGGTGGCTGCA
GCTCGATAGGCACAAGGTAGTCCGGGATCGTCGCCAGATGGAGCTGCACTGGCGCAGAGCCCACCACCTTGTCGTGCTCAAGCATGTTCAGATCACGCGG
GTTAGCCTCGAAGTGTGCTGCCAGGCGTTCGGAGTTCAGCATCTCCTTCTTCACGTCAGCCAGTTGCGCCTCGCGCACGGCCACGCGCGTGACAGCACGA
CGGACGTCCTCCACACGGTAGCGGAAGCAGTCAATCTCCTTCAGGTCGAAAGCTAGCTCCGCAGGCTGTGCGAGAACATCGTTTGCCTCGGAGCGGACGG
CCTGCTGCTTCGCCTGCACACGCTTCAGAGCCGTTCCTCCTTGGGGGAATCCTTGGACACGAGAGACAGCGCCGTACCAGAGGCACCACCACGCGCGGTA
CGTCCGATGCGGTGAGTGTAGGCGCGCACGCTTTTCGGGAAGTCCACGTTAATAACAAACTGAACACCGCGGAAGTCAACACCACGTGACACACCGTAGC
TTTCATCGTCAGCACGCCCACGCTTGGAGCCCACCGACTTCTTCTCCTGCTTCTGTTCATCAGCATCATCTGCCTCGTCATCGTCACTGTCCATGGCTTC
ATCGTCCTCCTTCTCACTATCGTCATCCTCTTCCTTGTCACTATCACTATCATCACCTTCTTTTCGTCCTCCTCCACAGCGTCCGATTCAGTGTCAGACT
TCTCTTCGTCGTCCTCCTTCTCATCAGCGTCCTCGTCTTCTTCCTCTCTCTTCGTCCTCTTCGTCCTCTTCGTCCTCTTCACCAACGTCGCGATCCACGC
TGTCGTCCGTGGCAATAAGGTAGTCAAAGAGACCGCGGTTAAACTCCTCAATAATGTGCTGACGCGAGTTGTGCGGCAACTTCGCGTTCAGAACTGCGCT
CTTGATCACGAACTGCTCAAAGAAAAGCTTGAGCCTGTACGCCGCCTCCGTCGAGTTGACGAAAAAAATCACCTTGCCGCTCACGACGCCCAGGCGCAGT
AGCGCGTACAGCAGCAGGTCCTTGTCAGCGGGTTTCACGGGCAGATAAAACTGCTGCAGTTTGCCGTCCGTGGCTCCCTCCTCGAGCTTCACTACCGCCG
GGTTGTGCAGCACCGAGCGCTTGAGCTTCTCCAGCTCGGGACTGAGCGTCGCCGACATGCAGAACGTCTGGCAGGCCTTAGGTAGCGCGTTGAAAATCGT
GCGGATGTCCTCTCCGTACCCGAACGACAGCACCAGGTCCGCTTCGTCGATGACAACGGTCTGCACCGATTCTTTGAGCGTCAAGTTGCCAGCCTCCAGG
TGCGCCACAAGGCGGCCAGGCGTGGCCACCAGCACATCGGGGGCGTCACGCAGCAGTGCCTGCTGCGCGCTCATGCTCTGCCCGCCCAGCGCCAGGAGAC
TCACCGTGTCCTGGCAGTAGTACATGAGCTCAGTCATGTGGCGGCGCGTTTGCTCCACGAGCTCCTTGGTGGGCACAAGCACCAGCGCGCGAACGGCCGG
GTCGCTGGCGGGCGCGTCCTGCTTGTGCTGCAGGATCTTGTGCAGCAGCGGCAGCGCGAAAGCCGCCGTCTTGCCTGAGCCCGTGCGGGCACGCACCAGC
AGGTCTTTGCCCTGCAGCGCCAGAGGGATGCAGTGCACTTGCACCAATGTAGCGTGCACGAAGCGCATCTTAGCCACCGCCTTGGTGAGGCGGCGGTCTA
GGCCGAACTCGCACTCGGCGAAGGCCTTCTGTCCATCCAGTAGCGTCTCGCTCACCTTGGGCTGCGCCATCTTGTCAAGTGCTCAATTGATGGAGTGAAG
CGCATGCCGCTTCGCTTTGGTTGGTCGGCAGCTTCAATGGTGTGTCAATACACCAATACGGTCAATTCACCGGACATCGGGCAGACCATCACTCCTGCGC
GCGCATTTTTTGAAATCGTGTTCAAATCGAATCTCTGCTGGCGGATGACGGAGCTAAGTAGCAGCGAGCGCCGCATGTCGTCGTCCTCGGTCTCCAGCGT
GCACGACGCGCCCCCGCCCCCGCCCACTCCCACGAACGTGCAGGTGGCGGTGCGCTGCCGGCCGCTGAACAGCCGCGAGAAAGCCTCGGGCCGCGGTGCC
GTGGTGCAGTGCAAGCCCCACTCGAACGAGGTGGCCGTCGTCAAGCGTAAGACGTACACGTTCGACCGCGTCTTCGGGCAGTATTCGACGCAAAAGGACG
TCTTCTCGTCCGTGGTGCGGCCGGCGGTGGACGAGGCACTGGCCGGCTACAATTGCACCGTGTTCGCGTACGGCCAGACGGGCACGGGCAAGACGTACAC
TATGCAGGGAGACCTCTCTCCAGATAGTGAGACGGCGGGCATCATCCCACGCAGCGTCCGCTGCATCTTTGACGCCCTGGAAGCTAGCGGAGAGGAGTTC
AGTGTCCGCGTGTCCTTCCTGCAGCTATACAACGAAGAACTCAAGGATTTACTAGACCCGGAGACAGACAAGAAGCTGAGGCTCATGGAGGATGTCAAGC
GAGGCGGCGTCTACTGTGTGAACCTGCTGGAAGTCACGGCCACAACGGCCAAACATGTGTACGAGCTCGTGAATACAGGAGTGAAGAACCGGGTCACGTC
CGAAACGCTTATGAACGAAAACTCCAGTCGCTCGCATAGCATTTTCACGATCAGGATTCACAGTAAGGAGCACAACGCCGCGGGTGAAGACTTGCTGCGC
GTGGGACAGCTGAATCTAGTGGATCTGGCAGGCTCTGAGTGTGTGGGTCGGTCGGGAGCACGTAATGCAAGGGCACGCGAGGCTGGCACGATTAACCAGA
GTTTGCTTACGCTGGGACGAGTTATCACGGCGCTGGTTGACAACCTCCCGCACGTTCCGTACCGTGATAGTAAACTTACGCGTCTGTTGCAGGAATCTCT
CGGTGGGCGAGCGAAGACGACGATTATTGCTACATTGGCACCGTGCGCTGATAGCCTTGATGAAACTTTGAGTACACTGGAATATGCGTTCCGAGCGAAA
AACATCAAGAACAAGCCTGAGCTCAACCAAAAAATGACCAAGGCGGGGCTGCTGAACGATTTTGGAAGCGAGATTGAGACGCTCCGTGCGGCCCTGCGAG
CTGCTAGACTGAAAGACGGCGTCTACCTCCCGCTGGAACAATTTACTGATATGCAAGAACGACTTGCCGGCCAGGGTGGGCAACTAACGGAGCTGGAGGA
TACGCTGAAGGCGAGGGACACCGCTTGTAAAGAGCTTGAGGAAGCTGCTGAGAAGTATGCGAGCGAGGTAGCAGTTCTTACGCTTGCGAAACAAGAGGTG
ACCAGCAAGTTGACCGTCACGGAAGACGAATTAAGCTCTACGAAAGAGATGCTGGAGAAGACAACCCAGGAGCTGCGAAATGCGCAGGCCGTGCTGAAAT
CTTTCCAGGACAACGAACAGGTGTTACTTGCCAACGGAGCTACCGCTGCAAAGCTATACAATGCCAGTGAAGAGCATGCTACACAGCTTTTGACGAAGAT
CGGTACGTAAGGCTACCTTTGATTTTTTGAGTTCTTGGCACTGGTGACCCACTACAGACTAACTCGGTCATTTGCTTTGACTAAAGAAAACTCCCACCGA
GCAGATGAAGCCAACACAGCGCTGGCAACTTCGTATCGTAGTGAGTCCCAGTCCCAGATTAATGCGTTCCTGGAGCGACTGGCGAAGCATAAGGAGAGCC
AAGAGGGCATGTTTCAAGATGCGTCCAACGCTCTGCATGAGCTGCAGAATGGTCAGTCAGCCGACTTGGATGGTTAGTAACAAGTCTGAATGCTCTGCAG
AGCCTGGTTGAGGCACGGAGAGTGCAGACTTCCGATTCACTTGCTGAAGACAACATTGTAAAGCGCGGTCAGCGCAATGAAATGGCAGCGTCAATGAACG
AACAACAGAAGGACATGCAAAAGCAGCTCGAGAAATTTGTTGAGATGTCAAAGACCCACACAACTGCTATTGTGAAGGACCTGGCCACGTCTAAATCACG
AAATATGTCGTTTCTGGAGACCGTGCAATCGACGTTAGAGGGATCTCGTGAAGAACTGAACAGCTTCCTGACTGAGCAGAGCGATAAGTTGCTAGAGCTG
CAAGTAGCAATCGACATGTCGGTTGAAAAGCAGACAAAGGAACTCGACGAAAGCAAGACGGCGCTCACAGCAGCGCTGAAGGACAGTCATGATCAACACC
AAGAGGAGCTGGATGGCATGAAAGTCCACCTTCGCTCAGTACATTGAAAAGTGCATCCAAAGCCAAACACAGAAACTCAGCGAGCAAACATTGCTTATCG
AAGAGAATGCGAAGAAACAACAGAAGCAGCTTTCGCACGTGCAGACTGTCACGGAGATAGAAGTGAAGGGCTTCGTGCAGTCCATGGGTAGTCAATCCTC
GAAGCATGAGAGCGAGACGGCTGCACTTCGCGAGCGTTTGTCTGAAATGCGAGGTCAACTCGGTGAAACCAACGAACGACAAACAGAGTTAGCCCAGTCT
CACGAACGGCTCCAAGCTATGTGGAGTGACGATACTGCTGCGCTTTGTAAGAAGCACACCGAGGGGATGTCTAACTTGATGGGGAAGCACACGAAGATAG
ACACCGAAACTTCGACTAGGAGAGAAGGGCAGATGACAAAGTTCATGTGTGATCACGAGGATCTCCGACAACTTCTGGACGGAGGATGCAACACTCTGGA
GAAGGGACTACAAAACCAAATTTCAACACGAAGGGCAAGATTGACTCTGCCTCCGCGTTTGTCAAGGAGATTATTGGTGAAGTGACCGAGGCTTCCAGCC
AGCAACTGCATGACATGGAGAGCTACATGAAGAAGCGAAAGGTAAGGCACAAACCTATTGTGTATTGATAAAATCAGGACTATTGCTGATGCGCGGACAT
GCTTTTTTTATGATCAGGTTAATGCACGGACGGGAGCTACACCGATGAAGAAGGATGATCGTCCATTCCCCAGCTTTGAAGCCACCGAGGTTGACGCTGA
GCAGTTGTATTCTCTCGAGAATTCGCCAAGCCACGCCAATTCATCGAATACCGAGTCTATTCCTGGTCGCAAGCGGAGGAGGCTGAGCGATGCCAGCACA
AGTGCAATTGACGACGCCACGCACGGCGTCGAAGACACCACCGCACAAGCCCAGAGCGACGCTCCGGTCAGTATTATTGAGACCACCAGGACTGTCACTG
CCGGTACTTCATCAGGCAGCAGTCAGGAATCCATGAACCTCAGGTCGGAAGCGGCTGGTGCGGGGTCGAGTGCCACTGCAAACGCACCTGAGACTCAGAC
GGAGGCTAAGACCACTATACCCGTCAATGGTACCCCATCAAAGATCAAGACCAAGGCACCCGTCACTACCGGCAATCGTACCCCATCAAAGATCAAGAAG
ATGGCATCATCTGCATTGCACAGGAAGAAGCCCGCCGTTGCCCACTCGCACAGGAGCATGAAGGTGCCCAGTGCAGGCGCTCGCAAGATCACCAAGACGT
CAACCCTCACCGCCCCGAAACGATACCGCGCTAAGTCGCCCTAGGCGAGACCACGAGCTTCCGTTAGCTCACTCATCATCTTGTAACCTTATCCGCTCGA
TGCGAGCGTGTCATTTATTTTGATGTCCATGCAAAGTTGCCTCAACGCCATTTGTACGTGACGTACCGTAGGTTGAAGTGGCCCTGCCCGTGATTGGTAG
AAAACCGTGATGAGTGTAACGGTCGCGATCCTATCCTCAGCTCATTTGACATCTGCCGCCATGAAGGACGCGGCATGGAAGAAGGCGGACGTCGTCGCGA
CGGCTGACGCCTCTGTGAAGCTTCCGCAGGGCAGACGCCGCTACTTGACGGCGTTCCTGTGTCTCTGCGTTTCTACCATCTGCTACGCCGACCGTAAGTC
CGCCTGCAGTGCCTTTTGCCATTGAATCAAAGTCTGATGCGATGATACAGGACCAACATGGGGATCGCGTTACCGGCCTTCGTCACCAACAAGAAGGAGC
AGGGTGAAGTGCTGTCCGCCTTCTTCTACGGTTACATGTGCACCCAAGTTCGTCACAGCAGATAGTCGAGCCCAGAAACAGTTCTGATGCTAGTTGTGTG
TTTCTGCTGCTGCTCTGTAAGTAGATCCCTGGAGGGTATTTTGCTGCCCGATTCGGCGCCAAGGGCCGTGCTGCTCACGGGGGTTATTGTTTGGACGATA
TTTGTACGTACAGTAGCCATTCGAGTGCTTGGTGCATTCTCTGATGGATTTGCTAAACAAAATCTCTCTCGTTGTGCTATGCCAGGACATGTCGACGGTC
GTGGTGGCCAAATGCCTCACATGCTTGTTCTTCACGAGAGCAGGCATGGGACTTGGAGAGGGCATTTTGTTCCCGTGCATGCACCAAATCGCTGGTGCGT
GGTACCCGGTCCAAGAGCGAAGTCGCCTGGTATCGCTGGTGGCAAGTGGCTCGGATTTGGGCACCATCTCCGCGCTGCTTATATCGCCGGCAATCATGGC
GGCTAGTGGCTGGGAGCGAATTTTTGTTGTCTTTGGAGTGCTCAGCTTCATTTGGGTCGTGGTGTACTCGATCATGGGAGTGAGCCGACCCGAGTTAGAT
CCCAAAATCACCTCGGAAGAACGAATTTTCATCGTGCGCAACCGCACCGTCGATCCAGAGACGCACCGTCGTCAGACCTCGAGCGCGGAAATGGACACTC
ATGCCATGAACTGGCGTGTGCTGCTGACCTCACGCCCAGCGTGGGCGATCTACGTCGCGCACATGTGCTACAACTACAGTTGGTACATTCTGCTGGGCTG
GATCCCTCAGTATTTCAACCAAGTCCTGAACCTTGATTTGACCAAGAAGGGCGGGTTTGCGGCTGCGCTGCCCTACATGTGCGGCTACACCGGAACTCTA
CTCTTTGGCCGTCTGGGAGATCTACTGGTCACTCGAGGCTACCGTGAGCTGCACGTGCGACAGGCCATGAACGCGTTTTCGTTCCTCGGGTGTGCCTTTT
TCCTTTTCTCGCTACGTCTTGCGAAGACGGCGCCAATGGCAGTTGCCTTGCTGTCGCTCACGCTGTTCACGAGTCGTGCTGCAATGGCTGGATATTGGGT
GAACATGATCGATGTGGCGCCAAACCACGCTGCACACGTTATGGGCGTCTCCAACACCTTTGGAACCATCCCGGGCATTATTGGAAACGTGGTCACGGGT
GCCATTCTCCAAGCGACGGGGTCCTGGGACCTCGTGTTCGCGATCGCTGCCCTTGTCCTCGTCTTTGGTGCTGTGTTCTTCCATTGCTACTCCTCTGACA
AGTCGATCTACGCGCGTCCTACCGGTAGCAGCAGCAGCAACGGAGACGGGTACAGCAGCGCAAGCACAATCTCGAGCAGCTTCCCTGGCAGTCCCAACTA
CAGCCTGACTCTTTCATCGTCGATTCCTGAGCTTCGTGACGAGGAAGAAAGCCTTCTCGAGAATCCAATGTGAGTATGGATTGCGATAGCTGTAAAATGA
CGCTGTCATTAACGTTAATGCTCATTCTGGCGCACGCTGTACCGGCCTAAGGCGATC