Description :
From Genome Similarity Track
Location :
Scaffold_185:7236- 8517
Transcript NameFunction/comments
Albla_Nc14093460myosinlike protein putative

Sequence
1281 bases(100 bases per row)
ACGAGCCATCCATCCTTCACGTGCTACATCAACGGTACCAGCGGGATAGAATTTACACGTTTCTCGGAGAGATTCTGGTAGCACTGAATCCGTTCAAGAC
CATTGAGGATCTGTATTCATCTTCTCAACTCGCCTTGTATGACCCGAGTCTCCATAGTGATCAGTTATCATCTCGACAACCGCATGTTTTCGCTGTTGGA
GGTAGAACATTCGACAGAATGAGAAGGAATCGATGCAATCAGTCGATACTTGTGAGCGGAGAAAGCGGAGCTGGGAAGACAGAGACTGCCAAATATCTTC
TTCATTTCTTCACTGCTACGCAAGAGACATTGGCGTCTGGGAACGACAATAGCTCAAAGATTGGGAAGTATATACTTCAAACAAATCCGATTTTGGAATC
GTTTGGAAATGCACTGACGATTCGCAATGACAATAGCAGTCGATTTGGAAAGTTTACAACCCTACAATTCGATGCAACGTCACATGTTCTCATCGGAGCT
CGAGTCGCATCGTATCTCTTGGAGAAAGTTCGCTTGATTCATCAGGCGCAGGATGAACAGAACTTTCACATTTTCTACGAGCTTTATTTCGGAGCGTCCC
AAGAGACCAAAAATCGACTTTTGGGTGGACAAAATTCTTTCCGTTATCTCCCACATCTTACACAATTCACCACATCACAACAAAACGCGTACACGAGTCG
ATACAAGAACACAATACAAGCTTTGAGCGACATTGGGACGCTCCAGTCGGAACGAGATGATCTGCTTAGTCTTCTTGGAGCCGTATTGCATCTCGGAAAT
GTGGAATTCTCAACAACAGATCAGAGACTCGTGGTTTCTGAATTGTGTGAGGAACACCTTGAGAGAGCTGCCGAATTGCTCGAGTTGCCAGTCGAATCGC
TATTGAAGCTGATGAGCACGAAGAAAATCCAGGCAGGTGGGGAGACGGTGCATTTAGACGTGAGTCCGCATCAAGCGGAAGAAATGTGTCATTCTCTCGG
TAAATTCATCTACTGCGGTTTGTTCGAATGGCTTGTTCAGCGTCTCAACAACACGATCGATGCTGGATCAGCGTCACAAACGCGCAACTCGCTTCTTTGC
ATTGGAATTCTCGATATCTTTGGTTTCGAAAATGTTCACCAGAATGGCTTTGAGCAGCTTTGTATCAATTATGCGAATGAAAGGATCCAAGCGCAATTCA
ATGAGTGCGTTTTCCAAAAGGAACAGCAAATATACAAAGAGCAAGGAATTCTATGGAAAGAGATTGAATATTCGGACAATC