Description :
From Genome Similarity Track
Location :
scaffold_61:7235- 10149
Sequence
2914 bases(100 bases per row)
TCCAGCCACTTCTAACAATCTGCGGAGAATATCTTACGTGAAGCAGGACTTCGGTATGATAATGTTCTTTGCTTGGGTTGATGACCTGCTAGTATATGCA
GATTCTATTTGAGCGGGTTTACTGCAATTTGGATAAGCACGGTCTCTTTCTGGGTTTGGATAAGGTGTGCCTGTACACGGAGAACGCCAAGTGGTGTGGT
CGTGTGATCTCGCCTGACGGTGTGTCTTACGACCCGGAGAAGATCCAAACGCTGGTTGAATTGCCTGAACCACAGACTGCTGCAGAGTTGCAACAATGTC
TCTGTGCGGCAGGATGGATGATAAACTCGTTACTTGATTTCGCACGAGTGGCCTCTACTATGCAAGACCGTTTGCAGGCAGCACTTACAGGAACCCAACG
CACCAAGCCGGCAGCAAGCATAACCTCCATCTCAACCACTGACGCAGAACGTGCTAGTTTCGCGCAAGTGAAGCAATTACTTGCTAATTCAGCTACTTTA
ACGATGCCTAGTGACTCGGACGAGTTAATCCTCATGGCCGATGCGAGTGACCGTGGGTGGAGCATACTAATGACAATTGCTTCCATCTGGAATCTTGCAG
CAAGTATCACCGAGCAGCACCACCAACTTGTGCATTGTTTGAGCGGAACGTTCAAGGGGGCAGCCCAGCATTAGAGTGTCTCCGAGAAGGAAGCTTTCCC
GATTATCAAGGCTGCTACTGATCTCGACTATTTGCTGATTCGTCCAAACGGCTTCCGATTGTACTCCGATCATCGCAACTTGGTATACCTGTTTGCACCG
GGTGAAGGAAAAAAAAACATGTACGCGGCAAATTACAACGATGGAGCTTGAAATTAACGGAACTTCGTTACACGATTGAGCACATCAGTAGCTCTGACAA
CATTTGGGCCGACATGTTGTCTCGATGGGCTGGTGCACCCAACGCACCTGCTACGACAACGACTATGAAGCGCTGGCGAGAGGAGAATGAAGCGGATGTA
TCGCAACTCCGCCCACTTGGACCTGACTCTGAATGGCCCAAGGTCAGCGACATTCACGCAGCCCAAGCATCTGCAACGAGCAACCGACCATCGCATCTAG
TCCAAGATGCGGACGGAGCATGGAGAGATAAGGACCAGCGTCTCTGGATTCCTGCAGAGTGTGAAGTGCTGTTGACGAGGCTGATGGTGATCGCCCATTG
TGGAACCATGGGCCATCGAAGGGTGAGAGGGATGTTCAACCACCTCAAAAAGCACTTCAACATTGCCAAGTTAGAGCAGAAAGCGCGCGACTTTTGCGCA
CATTGTTTGTTATGCAGACATGTGAAGGGGGCGATATTATCCCACGGCCTTGGGATGAATCGTACCGATCCAAGGAAAGGAATGAAGCTCTACACATGGA
TTATTTGTCTATTGGCGAATACAATGGCTGTCCTTGATGGTTCTCAAGGATGACTTCCGCACTTCTGTGAGCTGATCAAGTGCACAAGCCCCGATGCAGC
AACGGCGGCTAACGCCATTCTTGAATGGAACAGCAGATAACGGGATGCCTGATTTACTCGTCAGCGACACGGCAACGCATTTCAAGAACCAGCTTCTTGA
TGAGTTGTGCTATAAGACGCAAATGATGCAGAGTATCTCTATCACATACTGTCCGTGAATTAATGGCAGTATTGAGGGGTTGAATCGGAATATTCTACAA
GTGATCCGCGTGATGCTGTTAGAGCCCAAGATTGAGCAGGCCAATTGGGCAACACTCATCCCCCTCATCCAAGCGCACCTGAATCACAGTCCAGTGGTTT
CGCTTGCAGATCACGCTCCTGTAGAAGTGTTTCTTGGGGCAGTAGCGGCTACACCCTTGCAGAAAGTGCTCATTGGTGGCGAAACATTGGCCTCGAACAT
GCTGACAGTGGAGCGGACAGTGCCTAACGTGACATCAGTAGTTGAAAAGCTAAGGGAGTCAATTGCGGGTATGCATGGTGACATTACAAAGGCTAAAGAG
GACCAGACTCAGCGCAACAAACAGAACCAACGTGGAGCACAACGAGTCAATTTTCACATTGGAGATTTCGTTTTGTGGTCTCGTGTTGACGCGAAGGTGA
CAAACAACAAGTTGGCGGTGAAGTGGATTGGGCGGTACCGTATTATTGGCACCAACACCAACTCCTTCGAGATCGAACATCTACTGACAGGTGCAACGCG
ATACGTGCATGCGTCGAGATTGAAGATGTATGCCGACAGCAGTTTGAATGTGAATGAGGAGATTTTTGAACACATAACAAACTAAGATATTTTCCTTACC
GTGGAGGCATTCAAGGAGCTTCGTCAGCACCCCACCCACAAGTTCGAAGTACTCGTCAGTTGGGAAGGCTTGGAAGATGTCGAGAACTCTTGGGAGCCCA
TCAAGACGATGTACGAGGACGTCCCCGTGAAGTTGCAGGACTACATATCCAGTTCAGGCGATTCGTCGCTGAGTGTGTTCTTAAAGCAACTGCAATCGTC
CAAAACAACAACGAAATTAGCAGCGACTACGACGTCCGAGACTGGCACTCCTTCTCATCCAGCACAGCGTCGTCAAGGACGCAAGAAGCCGAAGAAGAAG
GCCACAAGCATGCGCACGTAGTCACCGTGGCATGCGAATGTTTGCTGGAGGGCGGTGTAGTGACGCCAGAGCGTTCTGCATCGCAAGCAACCATGTCGTA
TGCAACGGATGCGACTAGGAGCAGATAACGGACAAGGCTCAAAGGGGTTAAACAAACTTAACCTTTGCATTGTGCATATTCTAGCTAACATACAACTTAG
TGAAACTAACAGAAACTAATGCGGCTTGGCCGCAGCGGCTGCATTCAATAACAGAATTTGATTTACTTTCTACAGCGCGGGCTCTCTAGCAGCTTTGGGT
CAAGACCCACTACA