Description :
From Genome Similarity Track
Location :
contig_2:72342- 73523
Transcript NameFunction/comments
g497.t1RAW25616.1 hypothetical protein PC110_g17959 [Phytophthora cactorum

Sequence
1181 bases(100 bases per row)
GGAGCTGCCGAAGATGATCTGGATGGGTACCGTGGACTGCGATCTGGACGACCTCATGTACGGCCTCGTAAGCCAGAGCGACGAGGTGACCCGCATCAAG
TCTTCCTACTCCGGCAACGGCATTCAGGACTTTGCTACGCTCGCATCCCTGGAAACGTCAACACCTAGCGACCCGTTCTACGGGCTACAGCTCAAGTGGG
AGGTCAGTGGTGCCAAGGCAAATCCAATGTGGCGCTCCCGCGACTTCGTATACCTAGAGGCTACGGGTGTGACCAAGAGCCGTTCAACTGGCCAACGCAT
CGGGTACCAGATCCTGCACTCGCTGGATGTTCGTGGCGTGCCCGAACTGCCAGGACGCAAGTTGACTCGCGGCAAGATGACAATCTACCAGTTGTTCCGT
CAAAAGGCCAAGGGGACCGTCGAAGTATTCGCCAAGGCGATGGTGGACTTGGCCGGAGACGTGCCTGCTAGCATGGCCTCGTTCGCTACCATTAAGGCGG
CCAGCACCGTCAACAAGGCAGCCAAGTGCGCTCGTAAACGCAAACTCAACTGGCTGTTGGCCACGGCTGAAGCCAACTCAGTCAACTTTGGTGTTGGCAA
CAACGACTCATGCTGCAGTGTGTGCGCCCAGGGACTTCGGATGCCTTTGGGCAAAAGAGCTCCTTCGAGTGCCGCATTTGCACCAAGCGTGTGCCACAGG
TGCCACATCCGACAAAAGCTCAGCTTTGTCAAGCCTGACAAGGACTCGTTCGTCATCAAGCAGAAGGCGCTCGAGCTGTGCACGCGATGTGTGCACACCG
CCACGCAGATGAACGCTCGACGAGTGGCACTCGAAGAACGCGCACGGGAAGACCCCGCGTCCATGTATATCTACATTCCTCGCCAAAAGAAGTCGTCACT
CGAGGAGAGCTCATGCCTCGAAGAGCTCGACCTCTCAAGGGTAACGGAGAACGACGTGGAGTTCCCTCCGACACCCAAGCCTGCTCTCTTTGATCGGGCA
GCACAAGCGCTGTACTCATTCTTTTGAGTACAAGCCGCAATATCTAGAAATCCATCCGCTGTCTAGCGTCCTCATCCATCGGAAGATGAGAAAACATGTA
CTTGTAATACAAGTTGTAGCTTCCCGTAAATTATATAGTACTTCAGTGCCTTTCAGCGCACACTCCTTGTTCTTCTTCAGT