Description :
From Genome Similarity Track
Location :
Scaffold_324:7233- 9522
Transcript NameFunction/comments
Phyta_totarag7129myb-like DNA-binding protein, putative

Sequence
2289 bases(100 bases per row)
GATAGGCTTCTGTCGATATCGCGAGGTATGTAGGTGATGTCAGGCATTCGAACGTCTGTACCGGAAATGAACGCTCCTTTGGAAGTCATAAcgctgcctc
cttctccagacCACTTCGCCCACTGACCCAAAAGGCTTGCGATCTTGGCCGCCACTTTCTGAATGACATACAAGACCACTCGATAGGGGATGAAGCGGCC
TTCATCGATGAAAATTGCCGGCTGCTCGCCAAAAACGGGTTCACCAGTGGactgagcttcttcacgtgATCattcaactgcttcaactcCACTCCAGATA
GTCCTTGACGTGGCACAAAGTGTTCTTCGTTTCCAAGTCGTGCACCAGCCGCGAAAGCACGTCTTCGTGAGGtttctgcttgtccaccaTTTCTCCCTCG
ACGACTGAGCAACAGTTTCCACTCCAATGAAAAACCCAGGATGCGGCAATTAGCACTGGTTGATTTTTGTCTGTAATTGTTACAGTTGGTGATATTTCAG
ATTGATGGATGGACATTTTCAATCCATCAAACCAGTGTAAGAGTAGAGAccatgtattgtgctttgcaactattttgccgtccattttagccacctaaaa
cagacttcaattttagataaatggggaggattgtgagaaatgtgagctcggttttaTTGTTGCACTctataaaagtctgaaatgcaagcaaatcgctcgc
aattgcactcacagcaatgcaattcggtctttcaaaACACTACTGACGACTTTTCAGgagcgatctccatcttttAAAACCGACTTACAAAAGCAAGCAA
GTCGTAATTAAGAGTTACCCAAAATAAAAATgagtttttaacagacttatcaattcggttatgccaaaatatatgcaatgcacaataATATCTATAATAT
TATAAATCTCATAGGTAATGCTTGGAAAAGACCTCACGTTACCTCTCAAATATTAGCCGATCAGTTTCTTGTAAGCTTACCCAATAGTGCTATTACTCAG
GAATTCGACAGGAGTTATAGCTTACTTACTTAATGATATGATCTGTGTATCACCAGCAGAGTGGCGTTAGTaagatgaagaaatcaaGCGGTACATCAAC
AGCATGTAAGGTTGCGTCTGATAGCTTAAAGCACCTCTGGTGCACTCGTCCTATCTAGAGGTTCTGATCGTTTCTTTCATGCTGGTGAGTAGAAGGCAGT
AGGGACACGGATTGTTTTCGAGTGCACTTTGACGGGTTATCGAGTGCAGTACTTTTCATCGTAAAATGGAGAATTCATCGAGTGCAGATACCAGTTGGTG
ATTTAGGCTGCTCCATGCACGCTCGTTCACATAagtgaccagccgcgctTCGCTTGGCTGGGCGCCCCGGCGGTTTGCTTCGCTCGCGATGTGGAGATAG
AATGTACTGGCGAGTGCAATGCTCGTTGCGCTGGgatgctcggcgctgggcccgcctccgcaaataccgcgcggcccTGCTTCACGGGCACCTCGCGCag
gtttgctatggctacgcgcgctcgcaaccgcttgcCTCTGTTGGCGCCTCNGATCAAAccgtcaagttgaacaaGGGGCACTCGTTATCCCACCATTTTT
GCATAAAGTTAACGGTGGACTCGGTTTTCCCGAATTTGCACTCGAAAAACAACTCGTCCCAGATCGTGTTGAGCATAAATTACGGTAAGAAAAACTCTTT
GTTTTGTACTACAGTCATCGAACAGGCCGCCAACATCCGCTCCGTCCGGCAAGCGCAAACGTGCGCACAGAAGAACTTCGAGAAGCTCATGCGCCGCGTG
CGTGGACTTCGCAAGGATCGCAAGCCCTAAGCTCGCGTGGAATAATGGATGCACGATGAGATTCTCGGGTTCTGCGCGCTCACGCAGACGTCGAACTGCC
CCCTAAGTCCAGTCGACCTCGCCCAAGAAGGCTGTGTCAGCTATCATCTGCCCGCCCTATTGCTGTGCGGCGTTTGCATTGGACGGTCCCAAGATGACGC
ACAAGCTACCCCGTTCGAAGCAGTCATTGACTTTCTGCACCCAACCAAACCATCAACGATTTATAAGTACACGTGGTCACGACTTGTCAAACATCGGATC
ATCAAGATGTGCCGTAGTAAAAATGTTAGCAACATATACAGTACACACATGCACTGCATTCGTCTACATGAATCATAGTGCTGTCtagtcgtcttcttca
gAGCTCTACTTTAACAGTCTCGTCCCCCGCTTTGGACAAGCTCTCGATCAAGAAATCGAGCGACTCATCGATCGTTGGGAGTTGAGAAG