Description :
From Genome Similarity Track
Location :
Scaffold_151:72315- 76752
Sequence
4437 bases(100 bases per row)
GAGGGGAAAGAGGTAGAGAATCTCCTACTGTGGATCAGAGAGGTAGAAATAGCCATAACCTCGCATGCTCCGATTGGAGCAACAGTTAGTTAGGCTATCT
ATCTCAAAATTAGGTGCTTAAGCAAGAGAATGGGCTCTCACGTATAACACGTCTATAGTCGAAGCTTTCCGCACATGTAATTTGCTAAAAAAAAAAAACA
GCAAATATCCCGAGTGTTCGTTCCGCCTAATCAGACATATCGCGTGCGCTTTTGCTTTCTATCTGCCCGCCAGGGAAAGAAAGAACTATCGGACTATGTC
TAGGAATTGAGAAATCTAATCGCAGCCATGCAGCTTGATCCCTTACCAGAAATGGTTCTGGTTACCATCTTCATGGAGGTTCTTTGTACGGGTGTGGCTT
GAACGGAAGTATTCCGGGTCCACCTCACCTCCTTCGAGGCGGCTGTGGATATCACGTTGAACGCTGAGTTCAAATTTAAGTCAGCCCGCTTTGGAATCCA
AGGTATGACCCGAATTCAGAGAACTCATTTATTCATTCAATCAGCCTGGTTCTATGGAACTTTGTCTCGCCGAGACGGACGAAGAAGCATAGCTTCGAGC
TGTAGAACTACATCGTAGTGCTAGACGATGTTTCACGTGCAGAAGCACAAAGTAATTGAGCCCTAATTGTCCTTTACGTAAGTCACGTCAACCTCTTCTA
GCCGAACTCCGTTCGCAAACCAGAAGTATGGCACGGCGCGGGAAAACATAGACTCCAAGTAGGCACGGGGCGCCCTGTTGGGGAAGAACTAGGTTCTGTT
GAGCCTGTAGGAGGTAGTCGCGAACAGAACTTAGCCCCCAAATAGTTCCTTGTACTCTAACACGGAAAGAGATTACAAGCCAAGCTTTTTGGTCGCGAAA
GAGAATGTTAAGGGCTTTGAGAAGCCTTGGTCGATTTTGATCGAATCCGGTGCATCCTGTAATTAGTTCAGACGATGTCCTCTTGAAGGAAATCAATGTT
ATGCTGAGGCCCTACAAGTACAAAACGATGATACGATCACTGTTCGTTTAGCGACAGAGACTATAGTGACCTTGGGTTTGAGGATTTCGATTTTGATAGT
ATCGAACGCTGTTTAGTTTCTTGATTTAGACTCGAGATATGATCGCTTCTTGGGATGACCTGGCTTGCGCGACACGAACCATGTATCGATCCGAGGTCAA
AACATTAGGCGCACTGCTCCTAGCGGAGCTTTGGAGAGTCACGAACCCACCTTCGATAGGAATCAGAAGCGCTATTGGCGCGATCCACTGGTTGAGAAGG
TTAGTGTACTGACATATGAATGTCGGAACTAGTCAATTCTGACGATGCCAAACACACGAGTAGTTAGTAAAGATCATTTTGTAATAGTGAAACAGCACGT
ACTCCGTTGAGCGATATTCGTTGTGATAACAACGCACTGAATTCTGAAAGCGTTGTTGACCAAGCGTCAAGTCATCGAGGGTTGGACCCATCAGATGGGC
GTGGAGTGGCCCGTATGTAACCACTGAGTGACGTCGTCTGTGATAGCGACGCGCTGAATGTCAATGTTGACGTCGTTGGTATAATACAAAGGCATCCCGA
GCCCGGCTCAGCGGGTGCGCGTGAAGTGGAACCTAATTCACGTGATGATGAGCTCGAGCCAAATGAATCGCCATTGGATTTCTATAGTGACATAAGCTCT
AGTGTACAGCAAATTCAGATTGATGATGGTACTATTATTCAAGAAGAGTCATCCACTTGATCTCTTCGAGAAGTTCAGACTTACCTTCAGTGGCTATGAC
GCGCCACGAAGCGTGTGTTATGTCACAAAGTGATGGTTACTTTAAATATTATGCACTCGTTAATGGAGTGACTGGTATGTCTGCCCCTATACCCTCGTTA
GGCGCTTTGCTAGAACTCGAAGAGTGTCAGTCGATGAGTTTACTCACTTACTAAAGAATGGCGACCTTATAGAGTTGGCGGTCATTCGACCCGACATCAT
AGAGTTGAACTCGTCTTCGCTTCTAGATGCAGCTGTTCTAGAGGACACAAATGCGACACTCAGTGCGCGTATTCAGTGCGCGTATTCAGTGCGCGTATCG
AAGAATCCTCGCGATTCCTTTTATTTTTTGGTCAGAGAATTTCAAAATGTTATGTCACGACCCACTCGTTGTTTTACCTAAAGCTAGAGGTGGCGTTCAT
GAAATTGACTTGGTTTCTGGGACCAAATATTGTGTCACGACAGTGGCCCTTGCCTAAGGAGCAATGTGATGTCATTGATGACTTTTTCAAGCCAAGCACG
AGTCAGCAATGGTACGTGAGAGTACTTATCCACATCCGACACCGACATTTTGTGTCAAAAAGCCGAACTGCAAGTGGCGTATTGTGCATGCATATAACAA
GCTTAATGCGAGCACTTTTCCGGCACAGACACGCACTCCTCGAAAAGACGTGCTTCAAAACAATATGGTTGGCTGAACTATGTATAGTGCACTCGACTTA
GACGATGGATATTACCAATCACTCATACCAGCGAGTGATATTCCGCTGACTGCCGTGAGCATCACGAGTGGTATGCTATGAGAATGGCTAGTAATGCCCC
AAGGGCTGTCTAAAGCACCGGCTAAGTTTGATCGTCTGGTGACGCAAATTTTCCGTCTCTATCGGGATTATGCGCACGCATACTTTGATGATATTCTTAT
CCAATAATCATGCCGAGCAAGGCCGGTCGGATGTTGATAACTACATCGGTCATATGCGAGCTGTGATCGAGTGTATGCGCACGAATCAATTGTACTTCAA
CGCGTCTAAATGCATCTTAGTTTCAAAGGAGTTTTTTTTGAAGATATTTCATGGGTAACAGCAGCCTCAGAGCGGATCCCGCTAACGTCAAGGATATATT
TGACTCTCCGATTCCTAAGGATTAAAAGGAACTGCGTAAGTGGCTTGGCCTTGCCAATCAATTACACAAAGACAGTAAAATTTACGCTGATAAGGCTAGG
TCATCAACTGATCTCTTTGAGGAAGACGCAGATAGGCTCCGAGAAAACATCCATGCTTATGCATTTCGAGAAGTAAAGGAGAGTCTTCTCCATGCTCCCA
TTTTGGCGTTCCAAATACTGTGTAACTTTTTAGTGTCATCTGCGACGCATCCGACTTTGCCATTGGAAGCGCACTGTTGCAAACAGATGCTGAAGGCCGC
GAACAAGTTATCGCATTTGCATCTTGTCAGCATAAAAAAATGCTGCGAAAAACTATTCCGTTGTTGATGACAAATCGTTACTTACTATGAAGTATGTTCT
CGTCAAATTAAGAGTTCATCTGCTTGACTCCAAGCCATTCTTCGTCTACACAGATTATTCGTAATTACGTATGGCGAAACAGTAGACTCACCTCTTTCAG
ATAATGGCTCGTTGGCTCTCCTTCTTTGTGTAACTTTGAGGTGAAGTACAAACCGGGAAAACAAATGTATCGGCAGATGCCCTCTCTCGCCGACCTGATT
ATGAGGTTTCTTATGTTACGAATCTGTCGTCCGTCTTGAGGATTTAATTCGTGTGGCATATCGACGGGCTTCTCAATTCGTGGCATTGTTTCATTCTCTT
GGCAGTGACGAGTACAAGACTCGGACAGATCTTTGTCGACACGGTTACGTGCCAGACTACATCGATCTTCTGTGGCCTCTTGTGCTATCACAAAGATGTA
ACGGATACCCCACGCAGTGTCGTGCCTCTAGATGACGATTTAAAGTATCGTATCCTCTTTGAGGCCCATGATTCTGATCTTGGTGGGCATTGGGTCGTGA
AATGACTTATGGGTTTGTGAGTCAACACTATTGGTGGCCCAAACTCGACAAATGGGTGAGCACATACTTGTGTACATGCGAATGTTATAAAGGGTCAACC
CTCGGCAAATTCAGCTACGCCGCTCGCTAGTTTGCCTGTGCCCACGGGTTGTGGGTAGTTCACAAGCATGTACTTTGTGTTAGGTTTTCCCAAAGACTGT
GACGACTATACGAAGATTGTGGTCTTTGTTGACCGTATATCAAGATGGATCACTTAGCAGCACCTGTGCCGGACTCTATCGATGGTAAAGTTATGGCTAT
GCTGTTTATAGATCGCGTGTCGTCAATACGGTTTGCCGCTGGCAATCATCCCTGATCGCGATCCTAGCTCCAATGGTAATTTTTAGACTTTCATCTCCAA
GGTGCTTAGTACACGTTTAGACATGTCCATAGAGGATCATTCTCAGACCGTTGGTCAAACTGAACGAGTTAATTGAGTTATTGGCGATGTTTTTCAAAGC
GTTTGTGTTTATTCGCCAAATACTTGGATCTCGATGCTCCCTGTTATTGGATTTACGTTAAACAACGATGTACATGCCTCAATTAGCTTTGATTCTTTCT
ATGTGAATATTCTCACACACCCGCGCGTTCCACTCAC