Description :
From Genome Similarity Track
Location :
scaffold_798:7231- 10581
Sequence
3350 bases(100 bases per row)
TGAGATGCTTCATGCGGTGCTCCGTCGGGAGAAGCTTGTTGCGGCTTGTCTGGAAGGATCTTGACGCGGTCTGCGTCTGAGCGGCACGAATTTCATTGCA
TGCGAGCAGACTTGCGCTGATCCAGAATTTCCATCTGATCTTCCAACATGTACGCTTATCCGGAACGATTGCGGTGGGAAGAATCCATAATGATCCAATG
ACAGCACTTGGTGGGAAAGGTCTACAATCCTGACTCATCCAGGAGGGACTCTCGCACCTCTTGGTTGGTCCACTTGTTGATTAGCCGCTTGTACGCCTTC
TGTACATGATCGTACTAGGTCTTTCGTGTCTTTGCGAGATTGCTCGAGTAGTCATCCAAGGTTTGGTCAATGAAACCAAGTGACCGATTCACCAGAAAGC
TCGACGGTTCACCGACATGAACTCTACCAGCTCATCCAAAGGGTCCGAGAGATTTTCGAGAGCTGAGTCCGCGTGTGGAGCATGAGATGCTTGGTGCGGT
CCTGAAATATTCGGCCCCATGGCTTGGTCTCCCACAGCGCGATCAAGTCCGCTGGTTTCCAACGGAGTTGATTTGTTTGGCTTCCTCCGGCTTGGGAGCG
TAAGATGGTAATCCATATGACCTCTCCAGAACGTTCGTGGTCCCGGGGGCGTACTAGACCAGGATGCCGTAGTGTCTCTACGAGTTCACCCCCGAACTCG
GAGTCTCTATCTAACCAATGTTTCATCAGGAGTAACTCCTTGGTAGTTTTCCGGGCGAGCAGGACTATTTGCGTTCCCGAGCCTGACAAGACTCCCGTGA
AGGGGGCTGCTGAGGCGTCTTGGACGTTTCACTGGACTTCTTAGGCATGCTTGCAGGTCCTGAAGACGAATCCACACTCAAACTACGATTGGCTTCGCGA
GGAGTAGTGCGCCGATGCGACACTGGTACCACCTCTTTCGGGGTAAACGAGTCGTCGTTAGCCTCATCGTCTCCTACCTCGTCGTCAATTCGGACTTGCT
TCGTCAGGGAAGTCCAACTGCTGGATGTTCCCGGGTTCCAAATCTGCCTCCAAACGTGACTCAACGTTCTTGTAATACCAACTCGGTACGAGCTTCGTCT
AGGGAGTAAATCCAGGAGTTTCCAAGACATCCCCCGGGAGAGCATAGCTGAGAGGAGTCGAGAAGGAATCCGAGAGTGCGCCTCTTGTCGCTCTGGATCA
ACTCCTCCGCTTGGGCCAACATCAACCCGGAGCGTATTAGAGTCTGCACATCGTGCGAAGTTTGTCCCAAACCACCAGACCATCGAGAGACGCACACACC
GCGTTAACGCCCATGAGCGAGGACACGGTCGTGTCCAGGGCAGACTCATCACTTGGAGTGTACGTCGAGGGCGCCACTGGATGTCCCGAGACGTCGATAC
CTTGTCCGAAGTCTTGGACTTCTCTGGAGGTGATGATGAAGATGGAGTTGAAGAATCCTTTGAGAAATCCAAAGGGTCGTCCTTCGACCCATCGTGAATT
CCTGGGCCCTTTGAATCCGCCGAACCCTTCGAATCTCCAGGGTCTTCTTTCGCCTCCGAATCGACATCTGCGAACACGTACGGCTCCGACCGCAGCGTAG
TGTCATTCAAGGTGTTGACGAAGATCTGTGTCTTCCACGTTTCTGAAGGCTCTTGACGATCATGGAATTTTTCGAGAAGCGCTTTTAGGCGCGGCCAATT
GCCATCCACCCGAGTTCTGTGACGGTTGAAGAAGTTCATCAACGTGGGCGGGTTCAGTGTCACCGCCTTGAGGCGGTTCTCCATGCTCACGACAAGCTTA
CTGTATTTCGTCGTTTTCACTCTTCAAGGTGGAGATCTGCGCTTGAAGAGCGCGCTCCTAACGCTCGTGCTCCCGAACCTCGGGTAATCCTGAGCATGCT
GACCCAGTTCTTCGTAGATGTCTTCGGCTACTTGACACTAGTACTCCCTGTGAAGACAGTAGTCGGTCGAACGTGACGTGCTTCGTTGTGAGACGCCAGA
TCCCGCAGTGTCGCTTGATGACCGGGGATGTTGCCCAAGGCTTCCAGAGCGCGGTACTTGTCCAGAATGCGCTTCAGCAAGGTCGTCAATTCGAAGACCT
TGTGCGCCAGATCATCAGCGCTGTAGTGACGGAGGAGGGACGTCATTTCACGCTTGGTAGCGATGCTCTTCAGAGATACCAGGAAGTCGCTCGGGTCACC
TTCAACGGACACAGCCAGAGGGGTCAAAATCTCCCTCCGAATGTCGACATCTGGGCGCAACATTTTCGCGGATTCCTAGATGTCGAGCTCTGAGAACGAC
TCCACCATTAAGAGGCACTCAAAACCGCCGTACCTACCGCGAATTAGACTCCCACTCGTCAGGCCCGTTGCAGTCGCTGGGACTCCGACGTGCATTATCT
TGGGAGTGGCCTGACGCGGCAGTGGTGGGGCGATACAAGCTGGGGTGTCTGTCCTTTCAGGATAGGACGATCCTGTACCGCAACGCCAAAGTTATCTAAT
TCCGCCCTCGAGAACACCTTGTTCAGCGATGGCCGGAGAGTGCGCCGGGTGAGGTCTTCAGCCGCCGGAATCTGGGAAGGAACAAGAGTTGAAGCTAAAA
CCAAGTCTGCAGAGGAAACGTCACTTGAGGCGGTCGCTGTGCTCAAACCGGAGCAGCCCTTGCTGGAAGCGCGCTTCCTCTTGTTGCCAGGGCGCTCCTT
GGAGCCGCTCCTGCTTTGCTTGCCTTTCAAGCGCGCCGTGCTGGAGCTCCAATTCTTGTGCTTGCTTGAAGAACGCGCCGCGCTGGAGCTTCGCTCTTGG
GAGCGTCTTTTTTGGCTTCTGCCGTCTTGTTCTTGTCCACCATCTGGTTTTCGGGCGGGGTTGCGTCGGTTTTCTTGTTTTTGAGAGTGGTGCTGGATCC
GCCGTCTCTAACGCTGTCGTTTTCGATTCTGGAACCTGTTTGTCACTGGTTCCTGGCGTCTTATTCACTGCCGCGTCATGAGTTGCCTCCGGAGCTTGCT
CTTGAGCCGTTTCACCGCGCTTGACAGTCGAAGAAGCCGAGCCTGGACCGGGAGTTGCACCAAGTGCGCGTCGGGAAGTTGTGCTGGTCCTGGGGGAGGC
GAGCCGCTAGTTGGTGCCCGGTCGCCAGAGTTGCTCGGACTTTCGCTCATCAGTTGGTTAATTGTCAGCAGTTTGCGTTGTGATGAAAACCTCGGTTGAC
ACTCCGAATTGAACAGTTGGATGGTGGATGGGCTGCGATAAAGATCTAATATGGGGCAATCGCCTAACGGTTTTGCAATTCAGAATGTCTGGTTGCCCGG
GATGGCTACGTTCGTTTGGTTGGCTCATGTTCTGTCACTTCGATGGTAAT