Description :
From Genome Similarity Track
Location :
Scaffold_553:7231- 9262
Sequence
2031 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCGTTTCGGGGAGTGCAGAG
ATATGTGTGTTCTTGCATGGATTGTGAGACCGGAAAAGGTGGACCACCCTACAAGGGAAGAGATCTGGGAATATTGTGGCGACTTATCCTTTCCAAGTTA
TAGCGTTGGACCATATCCCGTCTCTCCCTAAGTCCTATAAAGGAAATACAGAAATTCTGATATGGGTTAATTAATTCACCGGATATGTAATGGCCAAGGC
TCGTGCATCGCGGACAACTCAAACGGTCGCTGAGGGATATGAAGAGTGTGTTTACCGTCGTTTTAGGGCTAGCGAAGCGATCCGTCACGAAAAGGAATTG
GGATTTATGTTTAATGTCTTCCGATCATTTAACAGGTTGTTGGGTCAACGTCAACAACCGACAATGGCCTACCGACCCCAAGCTCTTGATACGGCGAAAA
GGATGGCACAGACTCTAATTAGATCCATCAAGTTGTACGCTGCGGACGTGGGGCATCAGGATTGGAACGAGTACGCAGAGCGGTTGACGTTTGCGATCAA
TACCACACAGGACCGGGTACGAAAGAAACGCCTTTTTATCTGGTCCACGGTTGAGATGCCAGATCCAACCTTGAAGCCACGTTACCGAGAGTGAACGTCC
GACGTCAGGATTCAGAACCCAGACGGTGCAGTTACCGCATGTACCAGTGAGAAAGAAAACATGTGAATGAGAACTGCGAGAGGCGAGTCAGACGCGAGCG
CAATTACAGAACGAAGAGGTTGTCGACCACAAGATTCGACCGAGAACCCAAGTATGGATTTATCTCGACCGTGTAAAAGAAGGGTATGCCAGGAAACTGG
CTCATCTTGAGCACAGAATTTTTCCGCGTTCTGGATCTGTTGGGAGACCAAACCCAGGGTACCGAATACCGGTTGTTCCCGATTGTAAACATATCCTAGC
TCAAGAAATTTAGGTAATAACAGATCGACCAGACAACGAGCTAGCGATGGACGAGGCAGATCGAGTTGACTTCGACGAATGCCTATTTCTGGCAGGCAAT
TGGTTTCGAGAATTGAAGGAGGGCATAGACGAGGTCGAAGAGATTCTGGAGAGTCGTACTGGTAAGAAAACACGTTATGGGCTACAGCAACGAGATTTTC
TCGTTCGTTGGAAGGGGTACGAGGACCCCTAATGGGTGGATGAACTTGTTTTAAATTGTGGAGTATTACTGCAAGGGTTTGAATGCAAGCAGACGTGTCA
TAATCGGTTCGAAGCTATGCAGAGTCATGAG