Description :
From Genome Similarity Track
Location :
scaffold_676:7230- 10531
Sequence
3301 bases(100 bases per row)
TCTTTCAGTGTAGTAAGTCAACTATGAATCTTGTCGATAGACAGCAGTAATCCTCCCACCAATTGATTGCCTTTTGCTTTGCAATGTCAAATTGCATCTC
ATCTCGTGCGTCACTCCAACTTAATGAACTACTTGGTTTCGTCTCAATTGATGCTCTGTAAGCATGATGAATTGTGTCCCTCAGCCATCGCGGCGGATTT
GTCACTCTACCACTTTTCGTTTTCTTCGCAGAATGATACTCAATACACCCAGCTTTCTGTCGTTTGCGGACTCATGGTGAGGGTTGTAGCTCGAGGCTGC
CGTCAAATGCTTCTCTTCTGTATCACTACGAGCAAAAGGTTTTGCCGCTATTGTGTTCTTTGCTGAACATGGTTGAGAGTCTGGTCCACTATTATCTTGC
TTTGCAGTGAGATAAGATAATAGTGGACCAGACTCTCGTGTCATATACCGCTCATTGCCTCCCTTTGGTCTTTTGGATGGGTTTCTTACCTGAGCAATTG
GAGGATCATTTTGGCGTTGCATTCGTTTAACAATTCTCGCTCTTCTTTACTTGACACTGTCACAATTAGCGTCAATATCTCTTTTGCGACCACGCTGGAG
TCTTCCAGCGGTGGAGTCACTCTGACTTCTACCTACTGCAGCCTCATCAGTTCGGTACTCCGTGCCATCATCTTTTTGATCACGTTGCACTTATTGTAAT
AAAGATGGAATATTTTGTATGGCTATCGCATCAATGTCCAAGTACTGCGAAGCTGGGATATTTGTTACTGTTGCCGTGCCTTCTTCCACCAAGATCCGCC
CCGGCTTATTTTCATAGAAGATAACTGTGTGACTGTAGAAAGACTTATTTGCTTGCTATCCAACAAACGATAACCACGTTTCTCCCGAGAATACCCAGCA
AACACAGCTTCCCTAGCTTCGCATTCATTTTCTTACGCTCAACTTTGTCAATAAACGACAGGAGTGCACAACCAAATGTCCGAAGTCTTGAGTACGCAGG
TGATTCACAAAACCATACTGCGTACACCTCGTTGTATTCGGCACAATGCTCACACAATATGTCGCTGTCACGACAGCTTCCGCCCACAACTCTTCTGGCA
ATTCAAAGTGAACCAGCAGGCACCGCATCCGTTCCGTAATTGTGCGAATCATTCTCTCACTACTCCATTTTTCTCTGGAGTAAGCTTTACACTTGAAGTA
CAGTCCATTCCATAATTCCTCTAGCACTTATCACCTAGAGCAGCTAGCTCTCGAGCGTTATTACATCTCAACTCCTTCATCCGCACCTTTAATTGTGTCT
TCACACGTTCATAGTAGAGTTGAAAATGTTCGTAGAGCTCCGGCCGCTCCTTCATCAAGAAAACAGTCGAGAACCTACTTGCTTCGTCAACAAAAACAAC
GAAATAGCGCTTCCCGGGGTAAGAATTCACACAATATGGACCCCACACATCAGTGTGTGCACGTTCTCCAACTAGCCATTCTCGAGTGTTAACTCCTCGA
ACAGAATGAAAACTCTTTCGTGTCATCTTCCCTTTGACACACGATTCACAGGTGAATGTATCGTCAGGTCTCAAATCTGTAGTTGTAAGTGGCCGCTATG
TATGCCGGAACAACGCATTGAATACACTTCTTCCTGGGTGACCAAGTCATGTATGCCAAAGCTGCACCTTTGTATTGTCATTGGAACCGACTACCATAGC
CGTACTAATTGGACTCTCCAAGTCCAGGCAATACAAATTGGTTTCATCAATATGCGCGTATACATGGCCATTTTGGAACTTCACTTCTGCAAATTGGTCT
TCATCAAACTGTACGCTCACTTTACCTTCACTAGGTAGAGTTCTTGTAGTTTGGCGTTGTACTGAGAACAAGCTACATTGGAGTTCTGGTACATAACGCA
CACCGTGAAGCAACAGTGTAGGTCTCCCACGTGTTGTCTGGATTACCTTTTTCACTGTGCCAACACCAGTCACATTCAAACAATTATCTCCTCCAACACG
GATTGATCCACTTAGCCGTAAACGATACAAAGTCCATTTTCTGATTAGTAATATGAGTTGTCGCTCCAGAATCCAAATACCAACGCTCACGAGCCAGCAT
CAAAACACTACGTCTTTGTTTATCAGAGCTGTAATTACACGCGCTGTCGTCACTTTGATTTCCTGTGTAATGACTCTGAATAGAAGGTTTCTTATTTTGT
GTATTCTTCCCACGTTTTGCTTGCTTTTGAGCTAGCTTAGCTCCGTGATCATCACTTGGTGGATGTTTCCCTAAATGTGGACAGTCACGAGCTCGATGTG
ACTGCTCTCCACAGTGATAACACTTTCTAGTATTACCACCTTGCTCACATTGACAATGACCAGCTGCTGAACCTCCAACTCCTTTTCCTGGACCACGACC
AAACCCAAAACTACTAGCATCACGACCACGGCCTCTACCTTTGTCAGACCCACCGTATAGAGCTTGATCTTCCAGGGTTTTACCCAGTCTATCAAATGCC
ACTTCTAGAGCGTGTTCCAATTGCTCATAATTAGGAGGATGATTAACTTATCTGGGTACATGACTAGCCAGAAAGGTTTCTACAAAATTGTCATAGGTTT
CAGGTAATGTACCAATCAGAAGTGCTGGTTTCTCGTATTCGTCCAATGATTCACCAAGTAAGGCAATTCTAATTCACCAAGTAGGGCAATTCCATCCATT
AACCGGCGAACTTCACCCAAATGATCCGATACATCTTCATTTTGGCGGAGACGAAGCTGTCTTAACCCTTTCGTGGTAAAAGGAAGCATTGTGCTTCCTT
TTACCAATCTCTCTCTTTTAGCCAGTCATATTCAAGCGTTTCGAGGGATAGGTGACATTACTCGCACATTTTTACACGACTAGCGAAACTAGAATGTGAA
TTTCACGTAACTTCGCACTTTTTACACCCATCTATTTTGCTTTAGGAAGTTGCGGGTGATGAGTGGATTTGCTGAGAACAAGGCGTGCAGGTCTTGATGA
GCATCATACCGGGTGTGGGACGGCCCGCTCTAGGGAGGTATCTAGTTAGAGAAACGAAGTCACCATACTGAAATTACAAGATATGCCTACATGCAGTTTT
CATTTTGTCTGGCGATGCGCACAGATTTTATGGATGGGAAAGACAAGCAACTTGTCTCCCTCGCCCTTGAGTACGCGTCGGCGAAGAACCGGATCTCGGG
GAATGACCTTGCGCGCAGGGTGCAGAAAAAGCGTAGACTACAGGAACTGGAGCAGAGACTACGTGCACTTTAGTGCACGTATGGCAAGGACCTCACGCAC
T