Description :
From Genome Similarity Track
Location :
Scaffold_1392:7230- 8421
Transcript NameFunction/comments
Phyta_totarag12866hypothetical protein PHYSODRAFT_488281
Phyta_totarag12867conserved hypothetical protein

Sequence
1191 bases(100 bases per row)
TGGATCTCCAATACCTCGTGGATTTATCTTTTCGTAGTTCCCTGACCTCAGCAAGCTACTttgtcgacgatgaagacgacagcgaccaGCTAGGTGGAGG
GAACGTTCAGCCGAGCGTGCAGATTCCAACACATCTGCGTCGCCAACGTATAATCAGCACCGCAGATAGCGATGCGGCAGGTGCTTCTGCCAAGTGGAAA
TTTCTGCTTCACGGTGTGCACCGCATGGCAAACCGACGTGGAGCGATCTCAGTCGCTACGAAGAGCGAGGCTACGGTTCGGGTGCAACGCAGTGAACTTC
TTGTCCAGCTGTGTGACTTGACCCCACAAGATGTCGAGTTCCTCACGCTGTGGTATAGTTATAGTCCGGATGCAGAAGCCGAAGCCATCGCTACAGCAGA
CACCGAAGATGGCGAGAGCGGAGTCGTACGCTTGGACCCTGTACCCATGAGTCCATATTGGAGTGCCCGTTTCGAGCTCGCATGGAAGCAGTTGGCACTG
TCGACAACTGAGCGACTTGATCTCGCGATAAAGTACTCGTCGCTGGGATATTCAACCCGTCTTGCGGATGCTGTAACACTATGGGAAACTGCAGGCGCTC
TCGTCACCGAGCACGAAGATTTGCTACGCCTCATGCTCTCGACTCTCACAGGTCCTCGAATacacgccgccgccagccTCTCCGAGGACACCACCATGCT
TCAGGCACTTCTCGCCAGTGCTGTACATGTCCGCGAAATCCTCATGCTCACCTACGTCGAAGTCGGGGACTTTGTAACGTATCAAGGGAACTTTTACTTG
GCTAAGATGGAACGCGACACCACCGAGATCCGACGCCTAATGGAGCAGGGCAGGGACCCAAAATCCAACCAGGTacagcctccagcagcaacaaaataGC
ATCACCTTCGGCATCCAGCACGATCAAAGCTGTAATGAAACATACAAGGTAAATTCATTTAAAAATCCACAAAAGACCAGCAGACATCCCCAACATCAGC
AGGTCAGTCATACCGAGTCGTCACTTGCAGcattctccttcttcaccttcttgttcttcttcttcttcaatttcctggcctccttcttggccttttTCCT
CTCTTTCTCcttgtcttcctcctccgtcgtgTCACTACTGGTCGTCACGGGCTCTTCACTCTCCTGTTTCTTCGCCTTTTTAAGCTGCATC