Description :
From Genome Similarity Track
Location :
Scaffold_496:7230- 8239
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_496-fgenesh-gene-0.1Pentatricopeptide repeat-containing protein
Pytve_DAOMBR484maker-pve_contig_496-fgenesh-gene-0.4Sialin

Sequence
1009 bases(100 bases per row)
CCATCCTTTCCATTTTGGTCGATATGCAGCAATACGGGATCGCACCAACGAGCGAGATCTGCTCAAGAGCAGTGTCAGCGTGTGCTGTTCGCAATGACTA
CCGCGGGGTTGTGGACGTTTACGACGCTTTGTTGGTGATGTTATGCGACAACGACGTCTCCGTTTCCGAATTATTGGGAGACGACACGCTGTGCGACTAC
ATCCGCGCGTGCCGGGGCTTGAACGATTTCCAGCGATTGATGGAGCTGGAGGACCAGCTTTGCGAGTGGTACAGCTATAGCAAGGTTCCCGTCTCTTCAC
GCGTAGTGTTGGAGTTGATGAACGCATTCGACGATGCGGATAATTGGCGCCAGGCTCTGCGACTGCTTCGAGACATGAGCGCGACGTTCGGCATTGATCC
CTCAGTCACGCTGTTCAACCGCGTCATGGAAATGTGCAATGCGGCTGGCGAGTACCAGTCGGTGCAACTCATTTTCCTGACCATGTACAACGCGCTCGCG
TATCGCGTCGACCCGAACGTCGAGAGCTATATTCAAGCCATTTATGCGGCGGAGCAAGTGGAGAACTGGACGCAAGCGACCGATCTGTTTGTCGAGATGC
AGCAAAAGTGTCCCAAGGACGAGATTCGTCTCACCGATCTACGCAAGATTGCCTTGGGCCGCAACCGCGAGTTGGTAAACCAAGACAACCCACATCTCTA
AGTTCTTGGTCGCGACTTTAGTCGTCCAAGAGCCCGACTTCTTCGTCCCGGTGTTGGTGATGACGCGGCGATAGCAGCCCAAAATCTGAGCTGGTAGCGC
TCAGTGTGGTGGAAGCTGGAGCATACACGACGCCCGAAGTGTAGCTGGCGTTGTAGATCGACTTGTCGGACGCGTTGCAGTGGAAGAAGATGGCGCCGAA
GACGAGCACCGCGGATGCGATTGCGAAGACGAGGTCCCACGAGCCAGAGCTTTCCAGGATCTTCCCCGTCACGACGTTGCCTATGATACCCGGAATGGTA
GCGAACGTG