Description :
From Genome Similarity Track
Location :
Scaffold_470:723- 1909
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_470-snap-gene-0.8Ankyrin

Sequence
1186 bases(100 bases per row)
GCGGTACAGAACGGCAACCTCAAGATGGTCCAGTGGCTCTGCTGCGAGTATTGTCCGAATGGGTTTGTGTGGAGAGCGATTGAGGAGGCAACTGCTGCTG
GAGACATCACCATCTTGCAGTGGCTCACGACGCGCTACGAGTACACCCAGTCACACTCGAGGCTCATAGATATCGCTGCACTCAGTGATCACCTCCCAAC
GCTTCAGTGGATCCATCAAACTCTACCAAACGCAGGAGGCTCGCATCAAGCCATCGAGTTCGCTATCAAGAGAGGCGATCTTCAGATGGTCAAGTGGTTG
CACGACCATTTTCCTGAGCGCACCAGAGCGACAATCCTCAACACTGCGACCGAAAGCGGCTTTGTCGACACTGCCAAGTACTTCTTCGACCTCGGCTTCC
GGTACGTTCGATGCAACGGCTTGAGCCCCGCCGTCGAGAGTCGAAAGCTCGAAATGGTGAAGTGGGTCTATGAAATCGGCGAAACCCGTGGAACCGGCTA
TGAAATGAACAGCGCTGTGTACAGCGGACAACTCGAAATCCTCAAATTCCTTCATGAGCACCAGTGTGGAGAGATTGAGCCCAATGTGGTGGACATCGCT
GCCCAGCGCGGACACTTGAAGATCCTACAGTGGCTTCACGAGCATCATCCCGAAGTGAGCTGCTCGACCGAGGCAATGGACTGGGCTGCCAGGAATGGGC
ACTTGGAGATCGTGCAATGGCTCCACACGAACCGCACCGAGGGCTGCACGACGGACGCAATAACTGGCGCTGCTGGGAACGGCCACCTCCACATCGTCGA
GTGGCTGCACGCAAATCGCCAGGAAGGATGTTCGCCAGGTGCGGTCAGCTGGGCTGCTGCAAAGGGCCATCTGCACGTGGTCAAGTGGCTGCACCAGCAC
GATGTTGAGGGCTTTAACACGCTCGTGATGGACACCTCGGCGGCTTACAACCGTCTCGATGTGGCCCAGTGGCTGCACAAGAACCGCTCTGAGGGCTGCA
CCACAAGAGCAATGGACAGTGCGGCAAAGAATGGCCACCTTGAGATGGTGCAGTGGCTCCATGCAAATCGCAGCGAAGGATGTACGGCTTCAGCGATGGA
TGGTGCAGGCTCGCTTGAAACGGTACGATGGCTTCATGCTAATCGAAACGAAGGCTGCACTACCGTAGCGATGGACACTGCTGTGA