Description :
From Genome Similarity Track
Location :
Scaffold_1048:7229- 9596
Transcript NameFunction/comments
g16131.t1POM73266.1 Hypothetical protein PHPALM_9902 [Phytophthora palmivora var. palmivora
g16132.t1ETO58721.1 hypothetical protein F444_22899, partial [Phytophthora parasitica P1976

Sequence
2367 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACC
CCATTTACAATCAATACAGTTCTCATTCAGCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTA
AGTAAACTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCC
GTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCTGTGGGTAGCCCAAACACGTCTGC
AACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCACCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAA
CGCTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGCAACCACTGCTCGAGCTTCGGTGTCGCCATCGGCCACACC
GCGCGTGGAGTCATTAAAACTCCACGAAGCAGCTACTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAAGTCGACACTGCCATTGCGGCTCG
ACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTATGGACGCCGACTCACGGACCCTACG
TGCTTCAGCACGTACGAGGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCGGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAAC
AGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATTGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTT
CATGAAAGGCCTTAGAGATTGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTT
AGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTACCGCTGC
TGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCTCGCGAGTGCACAGCACCTGTGCACGCGGCG
AGAAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCTATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGT
CGACATCGGACACGCTGCACTGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAAGTA
AGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGA
TGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACCAAGAGAA
GAAGTTCGTCGACGAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGG
ATGAAACGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCGCCACGTGGTGCATGCGGCCCTC
CATCAGAGACAGCGCGGAATGCGGCTGTCTCCGATCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGGACCGAATCAGCAGGG
CCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGCTAATGTCGACACACAATTGGTCGAAAGACACTCCGCC
GTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATACTTGCGAGCT
CGCGTGCAGCCGGGCTGCACGACGAAGTGGTGCGCGATCAAGCCCGGCTTGAACGCGTGCGCCCGCG