Description :
From Genome Similarity Track
Location :
contig_43:72276- 73467
Transcript NameFunction/comments
g7452.t1hypothetical protein
g7453.t1hypothetical protein

Sequence
1191 bases(100 bases per row)
CAGACCTTCGAATCGGGGCGAGAGAAACATTTTCAATCGGGTGCTCTTTCACCACGGGCAGCCCACGTTTTGGGCTGGCCGTGCCTCGTTTCGATGCAAC
AGGGTCGGGTACGAGCGTTGTCTTGCTCTTCTGAGCGCGACCCTCTTCGAGGAATTGTCCAGCGAGGATCTCCAGCTTGGCCATGCACTTGCCGACGTAA
AACTCGATGGCGAGGCATACAACGCTGGCCTCGGTTGTTCGGAAGAGATAGTCTTGGATAATCGCGTCGCCGCTACCAGCGCGTGGCGAGCCTGGAGAGG
CTGGCGGAGGACTTCTACACCGCAGCAAGCAACAAGTGTAGCCCTGCTGGAATACGACCGACCATTTCTCCAGATCTGTGTAGTACCAGGTGCTCAGCAC
GACATCCGCCTCGTGGCCCGTGCAAAAGGAAACTCCGTGGGATGAAATCTCAAGCGAAGTGGCTTCAGTCGGGGATGTCTGCCCAGTCATCGCCAGCTTC
ACAGGGAAGCGGAGAACTTTGTCCGGGGCAATGGTTGCGTGCTTCTCAACGCACTCGGTTAGCACGTGGAGCCACACCTCGTACTCCGCTGGCTCCAGAG
CCGCAAACGTCCACGTCCGGTACAACGTCACCACGTCAAACGAGTGCATCACCGGTGTACTAGCGTTGCTGTTGCGACCGACAGGACTGGCTGCAGACAC
GGGGCGAATGCACAGCACGGAGCTCAATCGATCACTCGCCGTTCCTTTGGGGCGTCTGTCATGCCTGGACAGTGAGCGATCTTGTCGTAGTAGCACAGAA
TCCCCCACCGGAGTCTCAAACAGCACGACGAGCTTCGGGTGCCAAGCCTTCCGCAGGTGGAAGGTGCGCGCATTCTGTCGCTTCTGCAGTTGTCCTTGAA
ACTTGAACATCTTAGCATAGTGCACCGACTGGAGCAGAGACGTCAACGGCTGCATACTCTTGGCTGGGAGCGGAGGCTTGTCACGAGACAAGGTGGGCTT
CTGCCTGGTTAGTAGCTCACTCGGCGTCGACGACAAGCAGGAGGCGTGGAATTCACACAGGCCGCTCGTAAGAACTCGAGAGGTGCTTGGGTTTGTGCGC
AGACTGCTGGGCTCTCTGGCATTAATGTGAACCATCACATTCGACGCCGAGGCTCGTCCGGTTTGCTGCCGCTCAAGTCGGTGCAATCCAC