Description :
From Genome Similarity Track
Location :
Scaffold_73:72223- 73735
Transcript NameFunction/comments
Physo_157983hypothetical protein

Sequence
1512 bases(100 bases per row)
TAAACAGGTGCAATAGACACAGCCCCAACGAAAATGTGTCGGCCGCGAATGACTGCTCAGCGGCATTTCCTTCCAGCAGGTACTCAATAGGTGAGTTTTC
CAGTGTAGCGAACTGATCAATCGTGACAGGCTTTCCCAGATTCTCCAAATTCGAGTCAGCAGCGCCATAATCTGCTAGCTTCACCCAATACGAAAAGGAC
GCAGGCATTTGAAGAACGAAGCAGGAGTCTTCCAGAAGATAATGCAAAACGGCATCGGCCCCTGGCTCTTTGCTGAGACTGGAGCGGCCAATATCTTTTA
GAAAGAAATTAAGAAGCTGCATGGTAAACATTAAGCCCGTTAGCCACCAATCGTAACAAAAGATCATATCCTCTGGTAACAAACCTTGACATCACCATGC
CGTAAGTAAAACTTCTCTCGAGCGCAAAACAAACCGAACACCATCTGGAAGAAAAATGGCACGGCAACTGACGCCAAAGGAAGAACCTTGTCCTTCTGAA
GACCGATGAAATCTTCAAGATCGCCACCGTCACAAAATTCCATCCGGATGTACTGGAACAAACGATCGCTTTGTTTGCCTTGTTCGCTGCGAGGTGACGA
GGCACTCTGCTGGCTGCTTGAGGCTGCTGAGTAGGTGTTTCCATCTGCCAATAACTCGACTGGCCTGCGATGCGTTTTGCTGCCCCAACGCTCTTGTCGA
GGTCGCTCCTCCGCAAGAAAAATATCATAGATGCGGAGGAAGTTCGGGCATATGCCGTGCTCTGTTGCGTTCGATAGCAGCACTGAGTGGGCAACCTCTT
GCCGAATAACACCCTACGACGAAAGAAATCAAGTGATGAGTTCGAAAGGCCTACTATTCTATCCACCCGTACAAAGCAGTCGATGTTCGCATACCTGGTT
GCCGGTGTTTTCGATTGCACTGATATCCATGACGCTCATAGCTTCCAAACGCTTCTTTTCCGATGAAAATACTTTGAACACTTCCTTGTATGCACCATTC
GCGAGGTAGTGGCCACGTGGGTGACGACTGTAAACTTGGCCCATCGAATAGAAGTTGGTTTTCCTGAAAGAAAACAAAAGAATCAGGTACCCCTTCGTTA
GCCATCACAGTACATCGGCAAGCAACCCGAAAAAAAAAACTCTGTACGTACTTTGAGTAATCCGCGATCATCCATGCGTATGCCCTGCTCACAACCAACG
TCCCCAGACAAGTTAGCTTAAGTGAGAAATAGTACGACAGCGAGCAATCCAATAACTTACATGACCGCTATCTTTTCCCACACGGTGGAAACCTTTCGGA
GCACTTCCTTCAAGGTCTTCACATCTACCAGTCCAGAGTGGAGAACAAGGTGCAGCACACTTTCTCCAAGCGTGATTGTCTTCTTTGTAGAGATACTTTC
ACCGAGCGAAATATGCCGTTTGACAGGAGTCAGTGACATCTTGTTCATCTCGCGATCCCACACCCAGTCGTCTTCCGTTGGTGGGAGAAAAGAAGAAGAC
GAAGGTCCCATA