Description :
From Genome Similarity Track
Location :
Scaffold_2080:722- 6080
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2080-fgenesh-gene-0.1U4/U6.U5 tri-snRNP-associated protein
Pytar_ATCC12531maker-par_contig_2080-fgenesh-gene-0.0Pyruvate dehydrogenase E1 alpha subunit
Pytar_ATCC12531maker-par_contig_2080-fgenesh-gene-0.2Adherance factor

Sequence
5358 bases(100 bases per row)
GCACGCTTCGTCCCGCCCATTTTGGGTTGGAATTGCGNNNNNNNNNNCCCTCGTGGAGATCTTCATCGATCTCGTCGGACGCCGCACGCTTCGTCCCACC
CATTTTGGGTTGGAATTGCGATGGAAACCACACCACCTTATATAAAAAGCGCTTTTTACATGTACCCGGTTACGTCCCATGCAACAGGATCACAACAAGG
GATACGAAAGTGTATCCAAGTTACGTTCGTAGCCTGGGTTACACTTCTCCTCAACGTCATCCGCATGTGGAGACTCGACAGTGAAGCGGTTTGGCCAACT
GCGAGATCTGTCACCCGCAGGAGAATTCATCCCCACCGCATTGTCAACCATGAATGGAATGGAGATTGAAGAGCTACTGCAATTTCAATGGGCGATCTCC
GCAGGCTCTTCCTGGTATTATAATGCACTGCCTGCTCGCATGTCGACGAAGCCAGCGTCACGGCTGCTCACTCGCCGCCAACGTGAGGTGGCAGGTGACG
TCACCTGGTCGTTTTCGTACTTAGCCGAAGTCCTCGTTTGCTGACCGCTGCTTCGTCAGTTGGGGGCTAGGGGCTCCGCTTAAGTACGAATCCGGATCAT
CTTGTAGCTTGTCGTTCCTGCTGTGTGGCTGCCACAGAAATCGAAGCAGAAAAAGCCCGAGCAGCTCCGCAAACGTTCAACCCCCACGCTCACATCGCAA
ACTCTCGCTCTTCGCTCCGAAGTCCTCTGCTGTCTACGATGCTCTTCCGCCAGACCGCCCAGCGCCTCGCCGCGCCCGTCGCGCGCCTCTCGACTGCGCG
CTCGTTCAGCGCCGCCAGCGGCAACGTCACGTTCGATGTGGCCACGCCCTTCAAGCTCCACAACCTCGAGAGCGGTCCGTCCGAGACGGTCGAGACGAAC
CGCGACGAGCTGCTCAGCTACTACCGCCTCATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGTACACGATGCGCCGC
ATGGAGATCACGTGCGACAACGAGTACAAGGCCCGCAACATTCGCGGCTTTTGCCACTTGTACGATGGCCAGGAGGCCGTCGCGACCGGCGTCGAGGCCG
CGCTCAGCCGCACCGACTCGTGGATCACGTCGTACCGCAACCACTGCACGATGCTCGCGCGTGGCGGCACGGTCCAGGAAGTGCTGAGTGAGCTCTTCGG
CATGGCCTCGGGGGCCACCGGCGGCAAGGGCGGCTCGATGCACTTCTACCGCAAGAAGGAGAACTTTTACGGCGGCCAGGGCATTGTCGGTGCGCAGGTA
CCCGTCGGCGCCGGCCTCGCTTTCGCCAGCAAGTACAACCACAATGGCGAAGGCCTGATGCCGTGCGCCATCACCATGTACGGTGACGGTGCCGCCAACC
AGGGCCAGATCTGGGAGGCTGCCAACATGGCCGCGCTCTGGAAGCTGCCGGCCATTTTCTGCATTGAAAACAACCACTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTTTGACTACTACACCATGGGCAACAAGATCCCCGGTGTCTGGTGCGACGGCATGGACGTGCT
GGCCGTGCGCGAGTGCACCAAGTTCTTGAAGCAGTGGTGCGGCGAGGGCAACGGTCCCATCTACGTCGAGATGAGCACGTACCGTTACCACGGCCACTCG
ATGTCGGACCCGGGTGTGACGTACCGTAACCGTGAAGAGATCTCGCAGATGCGCGCGTCCCGCGACCCGATCGAGAGCGTCAAGAAGCGTCTGCTCGAGG
CCAACCTCGCGACCGCCGAAGAGATCAAGGAGCTCGAGAAGGAAGTGCGTGCCGAAGTCGTCAAGGCCACGAAGGAGGCCAAGGCGAGCGGCCGTCCCGC
CGAAGCGATGGCCTTCCAGGACGTTTACACGGACGGCAATGGCCACAACGAGTTCCCGCCATTCATCCGTCTGCCCGACTACACGAAGAGCCTGTACAAC
GGCAAGCCGCGCGCTTAAACCGGAGGCGTCGTCTTGGCCTCTCTGCTGTGAAAATGATGGATGGTAAATGAGCTGCAAACCCACGCACGCGAGGTTAGCG
TGTCTCGTGTGTTTCCCCTTGTAATAGACCATCCGATTTTCTGCACCAAGGAGATCGGACTGCGTAGTGCGGTCGGTATGTGGCAGGCAGGCAGGACTCA
AAGGGCAATTCCATACGTTGACATTTGAAGGATTTCATGTTACTTTTGACGACGCGGCTGATAATACGGAGTATGGGGACGAGCGTGTCGATCCGACGTC
GGGGTGGCCTTGCGATCCGTGCCTGCCCGCGCTCCTCCCTCTCTCTGGGTGGCACTGTACTCGGTGGTTCTTGGTTCTTCTTTTTCTTCTTTTTCTTCTC
TCTCTCTCTCTGACATACGCACACGGTCTGGACGGGCGTCTCTTACTCCATCTCCTCGCCCCGTGGTCAACGCGTGCGCGGAGCACTCGTTCGCGTGTGC
TTTGGGTACCGACGGGAGTCGTAGACGTCGGCGTCATGCTGGTACTGGTTACTGGACGGCGTGGGCACATCGGCGAGCCCACGCGAGAGGAGTTGGATCT
GGTGGTCCACTTCCATCTCCACAGATGCTCCTTTGCCGTACAGCACGGCGCCGTTCTTTGTCTGGCACACGGCGCGGCGCACGCGCGACGGAGGGATAAT
GCCAATGTTGCAATCAACGAACTCGTTCTGGCCCGCCGCACCGTAGCTACTGTACGTGATCTGCGGGTGCTGATGAGGGTCCTGGTTGTCCGGTGCCCCA
GTGTCGTCGTGTTCCTCCATGCGCAACGCCGCGACGCGGTGATGCACCTTGCGGCGAACGTGCTGCGCGAGGTTGTGGGTGCTCTTGGCCTGGTCGATGA
GATCCGGCGCACGCTCGGCAGCCTCCTTGAAACGGGAGCGCGACTCGCTGTTGACGCCAGGCACAGCATAGAGCTGCTCATAGCTGCTGTAGTCAACCAC
GAGCGTCTTCTTGCGGTTCTGTCCGCCTCCGCTGCGGTGGCGCTGGCGCCTCTTTTCGGTCGCCGTCTGCGGGCTGAAGGGCTCCACGGCAACGAACCAT
TCACGAGCAGGCGGACTGGACAGCGATGTGGGGGACCCGGTCGAAGTTGACGATGTCGAGAGGTACTGCAGCTTCTCCATGGTCTCCTCGTCCGACTCGG
ACGAGTGGCTGCTGCTCGCATCGTCACCGGCACCCATGCGGCTTTGGTGCTGGCGGAACGCCTCGATCGAGATGGCCAAGTCGGCGGGGCTGCCGCGCCT
CTTGGCCTGGAAAAGCGAGCCGCCCTTGATGATGCCGTCACTAAAGGACCGCGTGGGAAAGCTGGCTTTTGGGATCGACACAGCTTCGGTCGAGTCCGAG
AACGTCTTGTACTCGATGAGGCGGCTTCGAACGGGGTCCAACACGTCGTCCAGCGAGCGTCGCTTGCCGTGCGTGAAGCTTTGTGTGCGGCAAATCGACG
CGGCGTTGCTTTGTTGATTGTTGCTCCCACAGCGGATGCTGCTCACGTCCGAGTCCACGGTGATGGTCGACGCCGTACGTGACGCTGGTGACGCCACGTT
TGATGCGGCACCACAGCCAACGAGAATGCCGCCGTCCTGGGGCGCCGGCGTCTTGGACGATCGCCGCACGGCGATCACACAGGCCGTGCACACGCGCAAC
TGACGCTCGCCGACATCAGGCACGATCGTCGTGCGCACAGTGGAGCAGTTGCTACAAATGACTTCGCCGCACTTGAGGCAGTTGTACTTGCGGCGCAGCA
CACAGAAATTCTTCTCGCACACGTGGCAGTGGTCCTGCTCGCGCATGGCGAGCACTTGCTGCGGTAGCACAATCTCTTCCTTGTTGGCGCGGTAGTTTTC
GATGTACTTGGCGATGCCCGTGACGCACATCTCGACGTGCTGCTGGATGGCCGAGTTGGCGGCCCAGGCCGGGAGGTCCCCGTTCTTGTCAAAGTTGCAC
GAGTACGTGAGCCGCAGCTCGCCTTGCTTCTTGGTCGTGTGGTACATGAAGCCCATGAGTGGCACAAGGTCGCGGGTGTACTTGGTCGAGTCGATCGTTA
CGGGCCAGTGCGCGGTCGTGAGCGACGGCACGTCCACCGACTCCATGATCCGGAACGCGATCTTCTGGCCTTGGTCGTCTTCGATCATGTCGACGTACTC
CAGAATCATGAAGTCGCGGTCCTTGCCAAAGCGGCTCGAGCTCTTGAACGCAGCCCACTTGAGCGCGAGGTACCGGTACGGGTTCTGCTCGGTCGGCTCG
ACGATAGTCTGGAGCACGGCACCGTCCAGAAAGTCGGACGAGAGCATTCCCATCATCTTCTTGTAGCTCTCCGTGGAGCTCGTGATCATGGACCGCGCGA
CGTCTTCAATGTCCGAGTTGAACTTGTACACGGCGTGGACGTTGCACGGCACATTGTCGTTGGCCGTGTCGGCGCGGAAGAGCGAGATGCCGTGCTTCTC
GTGGACGAGCGACCAGGGGACGCCGCCGAGCAGGTCCGTGGCCATGAGCAGGTCCTCGGTCATGGCCTTGGCCACGGCCGTGAGCCGCTCCTTCTCCTTG
AGGTCCATGGCCTCGATGACGTCGAGACTGCTGTCGGACGCACTGCTGGAGCTCATGCTGAGTGGTGGAAGGAGGAGTCGTTGGCTTCAGACGGAAGGAT
GGAGACTGTCGCCTGGGGATATGGACGGAAGCGTCGCGAGCGTGGGGGGATCGCTAAATAAAAAAAAACTCCCGGGCAAGATAAATGCAGGAGAAGAAAA
TAGGCCGCTCGAATATGGGCAGGTATCGGATGCAGCCACCACGCGTCGTGTGGGGTCGGCGGAAAAAAACAAAATAAAAAAACGCTCGGACCCAGCCAAC
GGCAACGGCTCTGGAGAGACAGAACGCCCAGGTGAAAAAAGGCAAGAAACCCCTACTGACGAGTCCAGTCGGTGGTGGGCACCATGGTCGAGTCTTGCCT
GGCGAAGAAACCACGACCAAACACCCCAAAATCGCACGCTTCGTCTGTCGGGTGATTTTCTGCACCTTGGCACGTGCTGCGCCTTGTAGGGTGCAGCTGA
CCAGACACGAATGGTGGGAGCGCGTACGCAGCCACGGCCCCGGCCCAACCGCCGCAAACGAGCGAAAGTTCCCGTGCGAAATGCTTTGCCAACCCATACC
CAACCCAAGCCGAACCAATCGCCCTGCGACGGCACGGAGTCTGCGCACGTGCGTGCGTGCGGCGTCGATCCGTAATGCCCACTCCATACAGAAGCACAGG
ATTTCTATGCCAACTTTCTTCCATCGTTCTTGGTTGTTTTTTGTGCAACTTTTTTTTT