Description :
From Genome Similarity Track
Location :
Scaffold_446:7219- 8348
Transcript NameFunction/comments
Phyra_86070protein phosphatase 2C, putative

Sequence
1129 bases(100 bases per row)
TGTCGATATAAGCGACAATGATGGTGGTGTCGTCGATGACCTGCTCTTCCTTCATCCAGCGGCGGTTGGCCTCCATAATAAGCAGATCCACGGCAAGCTT
CGGGTCCTGTTGGCCCATGGCAATCTCCATGCACTCCTCGTTGGACATGAATTCCCAGAGACCATCCGTGGCGACAATGAGGCATCGGTCGTGTTCGTCC
AGCCACCGAGTGGAGAACTCGGGCTCCGACAGCACGCCAGCAGTGTGAGCAACCGCATCGCCCAGCGAGCGCGACATGGCGAGACCAGGGACGTCCATGT
GGCCAAGCCAGACACGCGGGGGCCCATCGATGCCGTCGTCGTACTCGACAGCGAACACACGGCCGCCACTAGAGATAATGCGGGCCTTCTCGTCGGGTCG
GTCAGGCTTGTGGTCGATGGACAGCTCTTGGCTGCCGAGCGTCTCCGGGCCCGACGGGCTCAGCAGCTTCACGAAGCCGCGAGTAATGCGCGAGTCGCCG
ACGTTGCCAACCACGACGAGGTTGTCTCGCACGACCGTCACGACGGCTGTGGTTCCACTGAACTCGGTGTCGATGCTGGGGTCACGCAGCACCGCCTGCT
CCACCGACCGCAGCGTGTCTGCAATGGCCGTGCGCAAGCTCTCGGCGTCCTGCTGGAGATCCCCTGAGCGCTCAAACTTGGCGTGGGCCAGAAGGTCCGC
CGCGAAGCGCTCGCGGATGGCGCCCGACACTCCGTCGCCAGCCTCTCCGTGTCCGTCAAACACGCACAGCAGCAGCGTCTGCGTGTTGTTGTCGTACTTG
ATCACCATGGCGTCCTGGTTCTTCTTGCGCGGGTTGTACGGCGCGTAGCCCTTCTTGGACAGGCCCGCGAAGGCCACCACTGCGCAGGTCCCGTCGGCCA
GCGCCTGCGCGCTGCTGTCCACATCTTCGATCGTGGCCGCCGCCATGCCGTCCACGAGCTTATTGTCGCTCACGACCGAGAGCCGACGCCGTTGCAGCCC
GAGCGAGTGGTCGCCTCCCGTCTGCGCGGCCGGGAGCTTGCCCGGCGTCTTGATGGAGATGCCCTTGGGCGACGCCACATTGGGCGCCGCAGCCTCCTGC
TGGCGGAGCTTGGCGATCGATCCAGTCTT