Description :
From Genome Similarity Track
Location :
Scaffold_5:72189- 73658
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_01852importin subunit alpha, putative

Sequence
1469 bases(100 bases per row)
ATGGCTGTGACCGACAAACCGGTTTCATAACGGTTTTCGACTAGTCGGTTTATGTCCGGTTAGATAATCGCTGATAGGCGGTTTGACTGGCGAGTCGGTT
ACTCGGATGTATCCGGATTCGAAGAACCGGTGGGGCGCCACCGGATAACGGGGTCGTGGAACGAATCGAAGTAGACGGCGTCGTACAAGACGTTTGGTTA
TCGTCGACATGTCGGAGGCGAAGAAGGACCACCGCCAGCCCATCAAGCGCATGCTCAACGGCGTCAATGGCCGGCGCGCCCGCATGGACACGCAGGTAGA
TGCACCTGATGGTCGCCACGATGGCTCATGCGCGCGGGCAGGTGTCTATCCGTAAGGCGCGCAAGGAGGACGGGTACAACCAGCGGCGCAACATGGCGGC
GCAAGCCAAGGCGCTGGCCGAGCTGATGCCGAAAGAGAAGTCGCAGATGCTCCACGAGATTGCACAGCGCTGCCAAGCGCTGCTCATCGGTCTCAAGCAC
GCCGAAGCCGACGTGCGGCGAAAGAGCCTCCGCGCGTTCGTGTACCTCATGAGCTCGGGTGTCCCGCCGCTCTTTGACGATAGCGACCCGCAGCATGTCC
CGCTCTGGCAGACAATCCTCGCAGCGATCCCGTTCTTTGTCGGCGCGCTCGACCTCGCGGACGTCTCGATGCAGTCGGATGCGGCCTTTGCGCTGCGCTT
CATCGCGTCCATGGACCGCTCGCTGTATGTCGTGCAAAGCGGCGTTCTGCCCAAAATGGTCGTGCTCTTGCAGTGCGGTATCTCGGAGCTCCAGATCCAG
GCGGCGTGGTGCCTCGGCAACGTCGCGAGCGAGTCCAAGGTCATGTGCGAGGCGGTCGTGGCGGTCTGCCCGCCACAAACCGTGCTTCCGCACATCCGCA
TGAGCACGCCGAGTCTGCGTCGCGCGTCCGTTTGGCTCCTTCGCAGCATGATCGACATGCCCGAACTCCTCGCGGGACTCGGTCTTCTCACGCCGCAACT
CGAGGGTGATGTCATGACAGTCCTCGCCAACGTCATGAAGCAGCTCGTCGTTGAGAAAACAAAGGCGCTCGCGAAGGAGCCGGCCGCGCCGTCGCCTGCG
GTCGCGACGTGGCGCTACTTCCAGATGGACTCGGGCCGCCCGGCGCCCAACGATATCGTGCTCGTGCGACTCCTGCGCGAGATTGACGCGATAACGGTCG
AGGTCGTCGACGTGGATGTCAACTACGAAACCGGTGAGTACTCGGTCTTTACGGTCCAAAAGTCAGCGCTCCGGCCGATGCAGACGATCGACGGCGACGA
CGACTCGGCCGAGGCCGAGGACGATGCCACCGAGAGCCTCACCTTGGACGAGAAGGCACTCACGCTCTGCGACTGCGCGTGGGCCATCATTGAAATGACG
ACGCACAACAAGTCGCTCGTGTCGACTTTTGTGGCGACGGGCGTTTTGCCAAAGCTCGTCGAGCTCCTC