Description :
From Genome Similarity Track
Location :
Scaffold_536:7218- 20899
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_536-snap-gene-0.11Dynein heavy chain
Pytap_DAOMBR444maker-pag1_scaffold_536-snap-gene-0.13Dynein heavy chain
Pytap_DAOMBR444snap_masked-pag1_scaffold_536-abinit-gene-0.19Dynein heavy chain
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_536-abinit-gene-0.27GTP-dependent nucleic acid-binding protein engD

Sequence
13681 bases(100 bases per row)
AGTTGTCATCTtGGAACAGGAtGgCGACACCACGAAGGACCCAcTTCTCACGGCCACAcTCTGTCGGTAGTGTCGCGAGGAACACGTACGTCGGACCTCG
GAACCGCGTCAAGTACACAGGGCACTCGTACGTGTTCAGGTCgTGGCGAAGATATCCTACAGACGTGGGCTCCCAACTTGGCTTCGTCTGCACGGCCTTG
ACGTAGACAACAGGCATCagCCAAAGCAGCTCCTTTGggTTGCTATCAAGCAGTGTGCCGCCGCATTCCGTCGCTGGAGACGCTCCCACTTTATACTTCT
CTGAGATCTCGTCAGGTGTCGACCATCGCGCTCCTTCAAGGATGAGACCGTGCACGAACACACCATCATCGGGgTAATAAGTCACCGCCGACGGGTCCTG
GAAaGTCGTGACATGCGTCTCGACGGTCATTTGGTTGAGTGGCATGAATTTGCGACGTGACGTGACTTGTAAACACGCAGTCGTGTATGCTGTGGGGTTG
AAGAGACCCGGGAGCCACATGGAGAAGGgCGTGACGAAGTCGACCGTCCACTTCTGTAGTTGCTGATGTCGCTTGATCATGtCcGTAAACCAGCCCGTGA
GAGATTtCTtGGACGgCcAaGCTTTCTTTtCCcATTTGCATTGTGAGAaCGGGTTCCGgCCGGgCACTTCATTCAGTCCGATGGCAGTCGCCAGATCTTC
CATTGCTTGCGACATATTGAGCTGTCCATTGAGACCTTTTTTAaGGtCTCCCAGCGACGTACGAATCTCTTCGAGCAGCACGTTCATACGATTACACTCT
TGCAGCGCCACGACGACAAACGGACCATGCTCTTCTGTCAGGAGCGGCGTCGCAACTTCCGTGATGTCGAGCATACTGAAGAACTCGGGGCATCTTGCTT
CAAAGTCGTCGATCGAAGATCGTAACGCCGCAGTCTTATCATTGGACCCGCCCTCGCCTCCACCACCAGAACCTCCTCCTATTGTCACGATCGTGTAGCA
TAGATTCTCACAAGTTGTTGTGAGGTACCCGATTTCGGCATTAGGATGTAAGCCGAAGAGTGGTGGGGACTCGGGAACCATGTTCTTCTCAATGTAGTTG
GCGTAATCAACGAATGAAAATTCATTTGGATTCGGAGACTTGAAaCCTGGGCCCAACTCCATGCCGTTCAATAAGCCGGGGTTGATGAGCACACTGAGAT
ATGTGTTATTGGCGCGTCGATCCCACGAATCTGTGATATGGCCACCGTACATGATCTCACCGAAGATATACCGCAGATCGTCCCACGGCACATTGACATT
GTTGTCCAGGTACGACTGCAAGATGTTTGCACAGATAGTGAGGTCTCCAGTGTTGAAAGAGTATGCTCGTGACCAGCCTTGTTGTCCGAAACGCTTGCGA
CCGAGCACGATAGCGTGGAACCAACATAATGCGAACAAACAGGCCTTGAATTCAGACGGCTTCGTGCTTGCCTGCACGCGATCTTCACTGAAGTTCGCCC
ATGCACGACGCAAGTTGGACTGAATGTCTGACGGCGCTTCGTTGGCTACTTTGATACAACTCTGCATGAGAGATTCAGGGATGTTCAGCATGTCTGGAAG
CGGCGGGGgCTCGGCAGAGATGAAGCAGCGGAACGTTTCATGGGCTCCATCCGTTGCGACCTCTTCCAGTTGGCGTTCAAGCGTTGGAAGCCACGACTGC
ATTAGATGAACGTTCTGCAGGATGATCCAGCCACCTTCAGTGCTCAGTTTCTTCACAGACTCACCAGCGTATGCTTCTTGGCCTTGACCCATAGAAATAT
TGATAAAGTTCCCGTTCTCAAGACTGACACCCTTTGATCTGCCGAGGTTCTCTACCCATGGTGTAGGGTCAACACCCGGGAAGAGAACGAAGAAAATTGG
AATGGAAGAGTTGGTCTCGTCAAACGTCGCCTCCATGTTGAAAGGAGGTTGAGTGACGTATTCTTCGCCCAATGAaTCAAGAATGAATGTACGCAATGCA
TTCGTAACACGATCTGGTCGCATCGCTCGTAGCAGAATGATCCGCTGGAATGCAGTGAGTTTGACGAAGTCACCAGGCAGCTTGTGTCGCTCCGCGTCTT
CTGTTGCAAACCAttttCGCCACTCATCTGGATCATTCTGGATCGAGTCGGGgAGAGCGGCAAAACATTTCATCGTCTCCAAAGCCTTTACCTTCGACCA
GATTGCAGCAGGCAGCCATTCAGATGCGGAACCAGCGTTGCCAGCATCAGGATGtGCCTTGCTGATAAGCAAAGCcTCcACCTCGCTGTCTAAAAGGAGT
CCATCCTTCAGTAGAATCTTGAGACAGAGCATCGTAGCTACGGTCAGCTTATCTCGCTCGAAGAGTCCGCGTCGCACATAGTTAAACACACACGACGTGA
TACTCTCCATCAATACCTTGCATCGtGAAGCCATCTCTTCATCCGTAAGATCAAGAGAGTTGTCCTCGATAATGCCTTCTTCTCCCTCCACCGGTTGAGC
TCCTCCTaCAGGAGGATCAGTCGCTTCGTTaTCTCGCTTGAGTGGGACACGATATATACCAGACAAGAAGACTTGTTGGAACGATGCGAGAGAGTAGATG
TAGTACGAGTGCACTTTGCTGATATCACTCATAAGGAAGAACAACAAAGAGCCACGAGCCGCAATACTGCGGTACTTCTCACTCGTCAAGTTGACGCTGA
TCTGTGTGACCTTGGCAACCTCCATATTGTTTTGAATGCGCTGGGCCTTGAACTTAGTGTCACTGAGAATCGTGATCAGAGGCTGGTTATTGGTGATATC
ATCATCTGCGTTTGCCAGCTCGGATAGAATCACATCCTCGAGTCGGTTCAGTTCAATTTTCCcTCGTTCTGCtCTTGAaTGAGgCGCTCCcGCTTCTCAG
CTAAATCGGCTCGCTCTTTTGACACGACTAAGTTAAGCAACTGATCTTCCAGTCCCAGCATTGTGACCGTAAAGTTCACGATTGTACACTCGGCCTGGAT
TTCGGGTGGGTAATGCGGATTTCCCAGCTTTGTGTGCAAATAGAGACGGAAGTTGTCATTGTATGGTACTGATGCATCTCCGATCTGAATTTCATAACGA
GCACCACGACGTGACGTCGAGCGTTGAATCACAGGTGCTAGGATCGGGTCAATCTTTTCGCCAAGGTTCTCGATCAAGAACGCGCCGTCAGTACCGATCG
CTGTCTTCAGACGTTCTATCCACATCTTCTGACCTACGCGGACTACGATGAGGTTATTCTTTGCTTCCATCTCACGAATCCACGCAATCGCCTGGAGCTG
GGGGTCgATAATTAGCGGACgaCGACCCATTGACACAGTCGTGCATACAATTGCACCGTTCTCGGTCGATACACGATCTGCCGGAAGACGTTGTGTATTC
CATTCAGCAATCTGCGCATCGTTGGTAAGGATGGCTAGAGGATTTGCCTcTTCTGACATCGCGATACTTTCTCCATTGGCAGCTTTTCTCAAATACGGAA
CCCAGTGCTTGTTGATCAGCTCATCTCGGAATGGTTTCGTGAACGGACCGATGTAAGAGATGAACGCAGATGCTAATAGCACATCGCCCACCAGAAGATC
CTTCTCCTTCTGTAGAGTCTCAACGTTGATTGCCCAGCGgaCATTCTCACTCGATAGATCGCTGGTCAGCTTTCCTGCAAGACGCATCTTTCGATTACCC
TGTTCCACAGAGTTGATTGCATCTTCTTTCTCTTTCTCTGCAGCTGCCGCTTCTGCCAGAAGTTTATCAAGTTTCTCCTGCAAATCGGCAACTAATGCGG
TCACCTCAGCAAGACGTTTGTTGGCGGACTCCAGTTCCGCATTtGCAGCCGCCAATGCTTGACGCTTCGGCTCCACGGTAACCAAGATATCGTAGTACAT
GACAATATTGACGACCCACGAACACAGACCTGCGGCAGCTTtGTTTTTGTCAAAATCGTGTCGTAGTTGAAATGTTCCTTCTCCAGAAACTCGCGCACCT
CCTTCCAGTTTAACACCGGGACCTTGCCGTCGTCAACAACCTGCTTAAACTGGATCAGGTAGTCAATGTACTCTTGAATATTACCGAGCAACTGCTTCTT
CACAGTGTCCCACTTGGTGTCCTTGACTTTGCCCGTTTTAGTGACCTGGACGTTGGGGTGAACGCCAGCCAGTAAGACCATCGTTGCGGCGAATACATCG
TCGACACCAGTTGGAGGCTTGGACATCGTTTTACATTCACCCAGATCTTTCTTGTTTAGGGAATCAAGGGCCTCCATCGCTTGTTGAaCTGCCGGTTCGG
CCTTCGCAAGATCCTCTTGTGTTGAGCGCTGTTTCTCTGTAACTTCCGCCTGAATCACAGCACACTTTGCAGCCTCTTCACTCGCCTTCTTGCTCTCAAT
CTCGACGTTCGCCTTCTCCTTGTTCACTGCCTCGGCAATACTTGACGCCACAGCCTTCTTATCTTCTGCAGCCTCCAGTTTGACTTTGAGCTCCACCTCA
AGTCGAGCGACTGTCTCTCCAGTTTCTTTCAATTTCTGCAGACCTTTATCCAAACGATCAATGGCTCCGCTATACTCCTTTACTTTTTtGTTCAGGATCT
TCTTGTACAACTGCAACAActCTAGATACGACTTCGGAGTAGTGTACACATAGCGGCGTTCGACTTGATAGAACCGTTCGGCGCACTGGTTTACCGACTG
CACTGAAAATGGCATGAAGTTTTCGATCCCTGCACGCGAGTTTTCATCCCCCAGCAAATCTGCTATTTCTTTTAGTTTCTCTCGTCCGACAGAAAGCAGC
GCTTCCTTTGGCCATGGCTGAAACCAATCGATAACTGTGCAGTTCACCAGGGCTGGGAACTTTCGCGCTCTGTTTCGGAAGTCATCTCCTACAGGAGAGA
AGCACAAGCACAAGTGCAGTCTCTTTCGAATCTCTGCTTGGTAAAACTTGATGACTTCTTTTCTATCCTTTGTCCCAGCCACGGGAGACAAGAGATTGAC
TATATTGTCCATATCTTCCATCGCAAAGAGGTCAGGGATCTCACCGGAAGCCAGAAGATCATTCAGATAAATCAAGAACTTCTCATTCGTGATCTGAGAG
TCGGTCAACATGAAGACGATACCTCCGTCCTCTTCATTTCGCGACAGCATGTCAACCACACCCATGTGCATCTTACGCAGATCCTCTTTAAATTCGTTTT
CGCCGTATTTTGAACTGATAGTGATCTGACGAACTGTGTATCCACAAATGTGGCTCGCCAAGCGTGCAAGAGAGCGTTTACCTGAGCCGCCAACACCGAC
CAGCAATGCGTGGCCACTCTCGTTGCGTAAAATGCGAACAATGCGAGCAACATGCTTTACGGCATCATCGAATAAATCTAGATGCATAGCTGAATTATTT
tCGTTGTTGTTGTAGTCCCGCAACTGGGCTTGTAGGTTGTGTTTCAAGTCATCAAGGTTCGTACCAGTTATTTGGTCGTATTCCGAGTCGCCTTCTTTCG
TGAAGTGGCAAAAAaTCAACGGCCAAGAGTTCTCAGCGGCATAGTATCGGCTAGTATTACATGCTGGGAATGAGCGCTTTACTTGAAGCTGGACCAATTG
GTTGTACTTTTCGATGTCCGCCTTACAAACGAGACGATCGCCATAGACACGTTCACTTTCATGGAGCCATAGAAGAATGAACTTTTCAGTCGACGAGAAA
CGCTGCTTCTTCGATGCAATGAGACCTTGGAAAACGTTTGACAAGTGACGAACATTGAAcTCGTAATGGAAGTTGGCCGCCGTCTTACGGAATGTGTTGA
CAACAGATGTGTGAAGAGCTAGCGCGGCTTTGATGAGAGCGTTGGAAAACTGAGAGTTACTCAATTCGTCCGAAAATGTTGACAAATGCCCACCAAGGAA
TGTTTCATAGATGGTGACAAGACTCGGTGCTTCGGGCATGCCCATTGCAAATGTGCAGAAATGGCGTTGTAGACGCGGATCAATCAGGAAAGATCCGGCA
GTTGGGTTCATACCAGCTACGTACTGGCAGCTGAGAATGTTCTGGTTCTGCAGTTTAGCTCGGTCAAACCAATGTTTATATTCCATCACTTGGCGAAGAA
GCGAAATGGCGCTCTGTGTGTTATACGGGTCCACTTCTGGTAAATTCAGATCGTCCATAAAGTAGATCAGCTTCGCTTTCCCAGGTGGACCCAAGTTGAT
ACCAGTCTTGCGTTCGAGCTGTCCAAACATTGCTTGCTGAAGGATTGCTGATGTGGTGTAAAAGTTGAaGTTAATCGTGCAATATCGAAAGGCGGCCGTa
GCTTCATCTTTACTAAGCTTCTTGAGCATACCGACGATATTCTGTGTTTTACCTGTACCAGCAGGACCGCACACCATCACTGGAATCGcctttGTGATCA
GATTTTCAAGCCAGAACGCAAtCGAGGCTGTCTCTGTAGTTGGAACCGTGATCTGGTTGATTGGACTTGGAGACTTGTACGTTTCGGTATAAAAGTACGG
AGATTTTGACCAGGAaTTAAACTTGGACGTCTCGGGATCGAGCCAAAAGTCGAATACAGTGTTGCTTGCTGATGCCACAAGTTTGACATCCTTCCACTGG
TTTTtCCACCAATTGCTaaaaTCTGCTGAGTAGTCTGTTCCGTCATCACTCATCGTGAGAATAGATCCGAAAGCCCACACACAACAAAACACGAACGTGT
TTTGCATAACTGTGAAGTCCTCAAGAACTTGGGGTGTTAGCAGACAATCGATCATGTTCAGTAAGTTCGTGACGAGTGTGGTCTCCTCGACTGGTACTAT
TGGGACAAGTTTTTTCTTGAAGAATTTAaGTGTTCCTTCAATGTACTGATCAAACAGTCCCTGGAATTTTGCGCGGGTATCCGGGGTgAACTGCATGTTC
TTAaGGCGATGATCAATTGGGGCTTGGCAGTGCACGTTGAGCCAAGAATCGATCAAACATCGCCACTGATAACCTTCGGAAGTCGAAATGTACAAAATAC
CAGCACGAGAAACTGTCGCGGGAGTTGCATAAACTAGATCTCGAATTTCAAATATCATGCGCATGTGGGGCTTCAAAGGGATACGTtCGTTAGACGCGAG
AGTAAGCATCCGATTATCGTCCATGACCGAATTCATCGACTCAATCCAGTTGGCATCTAAGTCACCATCTAGAaTAATCCACTTTGGATTGTTATCTTcG
TCCCCATTGTCTCGACGACGAGAACCGAGGTCTCGCATGATACGAGAGAGCagCccGTCCTTCCACTCACGGGTTTTAAGGACAATGTAACCGTACAGTT
CATTGGTACTGACTGACTTCGGGTTCATGTCCTGTACCTCCATGGGGATGCCCATAATCTCTCGAGCCTTCTTCAAAGTTTTCCAAGTTtCCGTTTTGCC
CGAAGCTGGTGgCCCcATGACGAATACGCAGTGACGGATTGCGAGCAACTCGGACAGTTGAACAACCTTGAGCATAAATTCAGGATGTGGTGAGTTACCA
ATTGCTTCTGATGCACCTTGTACCATAGACTCGAGCTCCATGTCTCGCTTGCGTGGTGGGTCGTTACGAACATCCACATTCGGCGAATCACGGGGGAATA
GATCACCCAGTAAACCGAAGAAAATCACTAAATCTTCAGCCACAATCTTCGGAATATTGAAATCGCGTAATGCACGCATCAGCAAATCGATTTCCGGAAT
ATCCGGCTCAGCACGCTTGAAGGCGCCGGCGACACACAAAACGGACTTCACCGCGCGAAGGCCCCAATCATAGTGCATTTGCTTGGATAACAGCTGTCCT
AACAACGAGTACAACCCATAaAATTTCGATGCGAGGATTTTCGCCTGGGTGAAACCTTCAGCCATCAACATGTTCTCACAAATCAACACAAGATCAGGAA
CCATGACCGTCATCGGTCGGAATAGGGCCTTCAGACCTTCTGGTAATTCAGATCGACCCAAGTAACCTGGATTCATAGTGATGAAAGCACCAACCGTCGG
ATCAAGCATCACCTCATCATTTTCCAGTATAAACTTCACATCGTCGGCCTTACACGCATCGCATACGGCTTTGAACTGGACCGAACACACAGACAACACT
TCGGGGACTAAGCGATTGAATTCATCGAAACAGCCCCATGAGCCTGATGATGCTAGACcTTtGAAAaTGTTTCCCAAACTCTTGTAATCCATTTCCGGCG
AGCAGTTGAAGACGTAGCAAACTTTGCCGAGGGCGTTCGCAAGATCTTTAGTAGTTTCAGTTTtACCTGTACCGGCAGGCCCAGCCGGTGCAcACCCCAT
TTGCAAGTTCAGAGCTTGGGTTGCCGTTACGTAAATTCGATCGGTCAATGGAGTGATCACAAGTCGAGGGCCATTACCGAGATACTCGTAGTCGTACGGA
ATGCCAGCGTCTGCGATCAAGATCTGGGCTCGCGAGTTGTTTATtCCGCGGAAATTCATGTCGCGCTTCAGGAATGATCCTTGTGCTGGAGAAAAGTAAT
GCTTCAGTTGCGATTGCCACTGGAACGATGTTGCGTCGTCAACTCCCGCTCGAATCATATTTGCGACGATATCTCGGCCATGTGCATCCATGGTGATCAA
CACCATCACTCGCTGTCGCTCTTCGGAAGAAATATCACTCTGGGTGAGCaTGATGAGATCTTCGAGTTGTTTCTCTTGAAGTTTATTGTAGTTTTGCAGA
GCATCCTTTTCACCATTCTCAGTCATTGCTCGGAAAGAGCGTTCTACTTCTTGCACgTAATGAACGCCGGCTGCCAACAAAATGATCTGAGCAGCATCGA
TTGGACGCCCGGTGTTCGGATCCTTGTAGTTGATCCATTCGACTCTGGGCATTTCAGTATACTTCACGAGAGAGCGTTCAATGTGGCGGAATAGTGTCAA
ACGCATAGCTCTCATCACAGTTTCTAGGTAAATTTCAGCCTCGCCGTCGAGAACAGGCGGTTCATAAAAGTCAACCGTTTCCTTTCCTACACCTGACACA
AACTGTGTAGCCATCGGACGCTCCCCAGGACCTCGATCGACCAGTGTGAGAGTCTTCGTTGCCAAGTAAATTTTGGAGCAGTGTACCATGATTCGCTCGG
GATGAGAGCCGTTCGAAAGGaTGTCGAGTAAATCTGCCTCTGACATGAAGTAGAAACGCGGAAACTGGCGGCGACGACCATCTAAGAACTCCTTCAAGCG
gTGCTTGCACAGCTCTAACTTCtCCACAATcTGCTCAAGCTTCTTGATCAACCCAGCTTCAGTGCAGGCATGTCGGACATTGAACGTCTTCCAGGCTTGT
TTCAAAATTCTCCTCACATCCACATCAATGTCCTCAAAATCAGACGTCAATTCTGGGAGCTGCTTCTTGACTTCTTCAGACTGAATGAAtAGAGGCTCCA
AGTAGCTCCACGATCGcTGGATATCGCCGAGCAATACGACAACTTCGTTGATCGACGATAAACCAATCTGCAAGCTCGCAACTCGGGGCTCGAACTCGGA
CTGATAGGGAGAGGCGCTCATTCCCTGCACATCGATTTGATGGGTCTCAAGCAGCTCGAAGTTCTCCTCTGACACTTTAAGAAGTGGCACTATATCTTCT
TCCGCTGCTTGAGGATTGTACGGAGTCATTTCCCAGTTAACTTCAGCCCAAATTCCCTCAAGTTCTATtAGCCGCAGCTCCAgCTCTTGCTCTTTCTCAG
CTTCATAGCAAATCTCAGTGATATCCGAGCTGTAGTTATGTAGGTTCTTGCTCATAATCAACCCGAGTCGTTGCTCAGGATCTTCATCAGGCgTGGGAAA
TTCACCAGTTTTGGCCATGATGCGTTTCCAGTGTCGTGGACGCATGTAGCTCGATGAGACACAACGAATCAGAGGATGAGTCTTGTCGAAGGACTGGCAT
TTCTTCAGAATCATTTGGTAcGCTTCGCTCCACTGTATTtCTTTCGGAATCTTCTTCAGCTCTTTGAGAGTCGACTGTATCTCAATCTGAAGGGAGTTAA
CGTCAACTTGTTTGAAGAGAATCTGACTAGTGcTTATGaaaaaaGCCTTTGTGCGCCGGATAATACCCCAAACGGTCTTCACCGCTTCCACATCGCCGCG
CATAACCCCCATCATGCGTAGGGATTCGTTCATGAGCTGTGGGAAACCGAAGATAGCGCAAAGCTTGGTATTCTCTTCACACTTCTTCATTTCCATTTCC
CAGTCCACCAAATAGCTTTCAATCTTCTCCAGTGCTTTGTCGGCTTCAAGCTTGTACGTCCAGAAGTCTAGAGACTTAaGCGTTTCCATCTTCTTCGCAA
TCGTTTTCTCGTACGACACGATGCGGTCTTCAGTCTTCTCACTAAATACACGGGTTGGTTCTTGAATGCGATTCTCTGTGAGTGGAACTTGTTTCTGCAC
ATCGTGAAAAAGCTTATCCATGTTGTCGATATCGACGATCTCTTTATCGACATGACCACCGTTCTTCTTGATGTGGCTAAaCATTTGTCGCACTTGATCC
ATGATTAGAATGTTGCTATCTTtCTCGACCTCAAGCTTTTTAAtAATCTCCTTCACTTTACGGAGCGTCTCAAGACCGTCTGTcTCGTTGCTAGGAATGT
CCTTCTTTAAgTCAAGTAGCAAACGACGGAATTCGCCATTGCGCTTGTTCATGCTTCCCATCACTCTTCGAATCATCTCAGCAGAATCGAAATCCTTCTC
ACCAGCGAGAGGAGGCATGCACTTCGCCTTGTTTTCCTCAGTAAGAGGCTGGAAGTTCACAAGAAATGGAGAGCCTCTAACCGGACCACCTATCCCAGCG
AAAGTTCCGTCAAATACAACCGATAGATGATACTTTCCGGCGGCTGGCGCTGTAAATGTCACAATATACGTGCCGTCATTTTTGtCTACGATACTCGTGA
TAGTCCGCTCTGCTgcATCATCACCTTTGGCTGTTCCTTCAGCACTCTTGAGCGTAATCGTGAACTCATCTCCTCCACAATCGCGCGGATAGTCATCCTT
AtCACGACTTTGGATAACGAaTGTCGTCGGATACTCCGCAAGGCACATGTCATGGAGTGCTGAGATCAAGCATGGaCcAAaGGCAAGCGATTTCGGAGCG
GCCGTGACGGAGTGGAACTTGAATGCTGtcgAGACATTTGTgTACGGCATACCAGATAACGACGCGCGCACTTCAGCCAAAAGTGGCCATATTTTtCAAA
ACTTGGAGCTGTCGCCTGAATCAGCGCTTCATTCAGCACAGCCCCTTGGACGTCAACAAAACCTTTCGCAACAGCAAATCGAAGCGTAGCGTTTTGACCA
ACAAAGTTGTATCCGTGAACTTTGACTTTGGCATTACCGGTGATCGGTCCTGAAGTTGGTTCAATTGCGGAAACTGCATAGGgCGGTCCAACCACTTCGC
TTGCATTGAGAACATGAAGATCGTTGAACCAGCGGTTTGCCCACCCACCGAAGAAAATCATGTAGTTGGTGTTTTTGTCAAAAACCATGGTCGTGTCTGC
ACGAGGAGTTGGTGCATCACCTCGAACGGGTGGAGATTGCCATTGCATCGATCCAGTGTCAAGCACCAGTACTGAGTTCAGATACATACCTTGTGCGGTC
CCGGAcTCGGCTAGATCTCCGCTGTtCCCCCCAAacATAAATACTTTCCAGTGCGGAACTGCcGCAACACTCACACATGTATGATTCCATGTCGGCGAAG
GTAGCTTAACCTCTAACGTAGTCCACGTTCTTGTCACCAAGTCGCACaCGAAAATGTCTTGAAATTGCTTgAaGGAGTTCCAGCCACCAATCACAAACAa
CTTCTCCCcAACAATGCACGTTTGGTGTCCTGACCGAGGCTCAGGTTTATCTCCTTCTGTTTGAATCTCCTCCcATCGCCAATGCACTAGATCGAGAGCG
TATAGATCGTTGAAGTCGGTTCGGCCATATCCGTTGCCTCCGTAGCCaCCAAATATATACATCTTGTCGCCAACAaGCGTTGCGGTATGGGCACCACGGC
ACTGGGGCAGCCCTTCCcAGAATCCATGAGCATGCTGTTGCTCCCAAATGCGgAGCTCCGTGTCAAAAACCCACACGTCGTTCATGCGCTTCTCCGCTGC
GAAGCCACCGAATATGATtAGCTTTTTCTCCCAGAGCACCGctGAATGGCGCCATCTAGGCGGTGGCAGATCTTCCGgACCGTGTGCTGTTGGAATGACC
TTGGACCACGAGTAATTGCCGTTgTTGATATCGAGTTTGAACAGGTCGTTCGTTGGaCCAGGCGGCGATTTGTGATCACAACCACCGAACATGTACACAC
ACGTCTCaGTGTCTGTGCTCTTGAGCGTGAAAGAGTGGCCGGAGCGCTTGACAGGGATCTCGCCACCCTGCTTTGGCGCGAGCCACGCCATCTCCGGCTC
GGCGCCATAACCGATCGGCTACAAGGGTACCACGACAATTAAGCACCCTTCACTCTCTCTTCATCGCCACACAGCCGCTTGCACGTACCATgaCTGCTCA
CGTCCCaGTCGATGtGGGTAGAAGCACTACGAaGCACAGCGTTGAAGCGCTTCCAACCCACAccAGTGAGGGCACTGCCCGATGGGGAGCGCTTGCCCTT
TCAATGCGACGCGTCCCTTCAGTGTCGGCAGCGAGGTTTCATTTtCTTAGAACGCACGACGGGACGCACGGGGCCGCTTACACCGCGTTCTGTCACATTG
GCCCTGCATGCGCgaCGACCCTCAATCCATAGCGCCAAAGCGTCGCGTCAACCCGCCTCCATTTtGAAACCGACCGCGGGGAAACCATGGTGCggaacGG
AAACACGaTtGTTACCcAGGTTGTAACAGTTAAGAaCACATGCATAGTAACCCTCGTGTAACCTGGaacTGAAGCATTGAAGCAGAAGAAAGGCAAGTCG
TATTcACCAGAGTgtATGTTAATGGCACTATGGCTAGCGTGCACCTATGAACTACGAAAGCGGTTGATAAAGCACACATAACGAGCTGCTAGGGCTCGAG
CGTCACGCTTAGGTGTTGAACTTGAAAAaCACAACGTCGCCGTCCTGCATTTCGTACTTCTTGCCCTGCTGCTTCAACTTGCCGGCCTTCTTGACTGCTT
CCTCCGATCCCACTGCATgaTATAAACAAGAGTGTCAGCTCTTGACGAGGATTGGTgCTCGTACGACAGCAGCATAACTTACGCTCTTTCAGGTCGGCGA
AGGCCTGGACTTCAGCCATGATGAAACCACGCTCAAAGTCTGAGTGGATCACACCGGcAGCCTGTGGTGCCAGACGACCCTTACGGATGGTCCAGCCACG
AACCTCGTCCTTACCAGCGGTGAAGAAGTGAATGAGGTTGAGGGCGTGGTATCCCATCTTAAGAACACGGTTCAGAGTCGACTTGTGCGTTGGGTTCTCC
TTCAGGTACGTCTCCAGCTGGCCAGAGGCCTCGAGATCCAGCAGCTCAAGCTCGAACTCGCAGCTCAATGGGATCAATGGCTCATCACCACCACGCTCCT
TGATGAACTCGGCGATCTTTGGAAGGTACTTGTTGCCCTTGCGGAGGTAGTCCTTCTTGCTCACGTTCACAAGGAACACCACCGGCTTAGCGGTCAGCAG
CTGCAGCTGGTTAAGCACGTCCACCTCAAGGGCATTCCACTGACCAAAGGaCACATCCTTGCCAGCCTCAAGCCACTGCTG