Description :
From Genome Similarity Track
Location :
Scaffold_20:72179- 74435
Transcript NameFunction/comments
Phyke_g1261hypothetical protein PHYSODRAFT_558953

Sequence
2256 bases(100 bases per row)
TTTTGATGTACTCGTTTCTGATACTTCCTTTGATATACTTCCATAGCCGTAGCCCAGCGAAAAAACCGAGTGCCCCTGCTGTGTTAGCACCACTTCTTGG
TGACTCGACCGAGGTATGCGTTTCATAGCTTCGTATTCCTGGCTTTCGATGGTCAAAACCCGCTATGTTGATGTACGTTCTTGACAGCCGACCCTGGAAT
TACCGCCAGTAGTCTTCTCTTCTGCTCCTGCAGAGTTGCCAGACGCATTGTTCGAGCCTATTACGCGGCATACACGAACAGACTGTTCCGGATGCTCACA
GCAACCTCTTTTAGCGAGGGGTGCCAACTCGTCTGCATAATCTTCTTCGAAAAATCCAGCGCATCAGGGTCACCTGGAGTCGGCAGTGCAGCAATCTGCT
GTGCAAGTCCACGCTGTGGCATTGAATGACGGCGGCTCACGcgtgctgttcgtggcgTGATGGAAATGTCGGCGCGCCCGTAGCGGTCATAAATATGGAA
CTCGCTATTGTACGAGCCCGTGATAAAGTTGTTGCCGTCTCCGCTCACCGCACACTCGaacttgtcgaagatgcagTCACTCTCGTAGAGATCTCCCAAC
CGTGGGCGCAGATGCTCGTGGATCTACACAAGAATATGTTTCCCAAATGAATTATAAAACAAAACAATTATTAGCAAGGCGAATCGGCTCATGAGGACAG
CTACACTGAACTGTCGTGTGCCATGCAATCCTAGCACAACTTACATTAATCGTTTGAACAGGGCGCGAGTTCATATTGATATCCCAAACTTTGAGCGTGA
GATAGTCGCGTGCTATGATATAGCGGCCATCGGGCGAAAACTTGATATCCGATATGGACGCAATGATCTCGGAGAAGAAACTTCTCGCCTCGGggtcttc
ctgctcttcaaaTACTGCAGTTCAATCCATCGAATGCATACCATCAGACAATATACAAACATGTCCGGCGAGATATCGGTCAGAACAGCAGAGCACATCC
AATTGAACACCAAGCACACACCTTGAGAATACGAGTCGCACAGTGCCGCTTGTCGCATGTCACCCAGCTTGATCGCACCACGACTTGTGCTGTACATCAT
CGTGTTACAGTGCGTCGGATGAAAGTCAGCGGCCGTGATCACCTCTGTCAGTTCCTCCATATTCGCCGGCTTGATGTCAACGATATCTGAAAGTGTAAGC
AAGCACACCCAAATGTACATCACATTGGgatcagcacaacaaaacCGACTTATCCTTATACAAAGGCTGCTACTTCCAACTCGGCATGGATCgttggcaa
cagcaaataAAAACAGACCAACAACCACTTACTGAAGCTCTGATTCGAGATCCCGAGGCTCCACAAGTTCACGCGCAGATCGTCTGCCGACATGAATGTC
TCTCCGTCGCTGTTGATCGCGATCGAGTTGATGTGGTATGTGTGCGCGTTCGCGTAGACGCGCTTGGCTGTGGTCGCCGTCACCTGGCCACGGATGTGGC
TCTTCGGCAGACGTATTAGCTCCGGTGTGATCTGTCCGTGTGGCACGTGGACCAGGCCCTGTTCATTGTACGTCGTGACCTCACGTACGCTACGTTCATG
CACCTTCCAGAGTTTGATGGTCTTGTCATTTGTGGAGAGCAGACACTGGGACCCGTTGGAGGGTCGGCACCACTTGATTTggttgatcttctcctcgatc
tcgAGACTTTTGAGGTAATCGAACTCAGCATTATGACTTTGGTACTCAGTGTACAAAGTATACTGTGGGTCGTTTGGCCCTGTGAACATGGTTTGGTTCT
GTGTAACAGCAGAATTACGTGTTaggaaaaaaaaaatagcaCTGTTGAATAAAATGAAAACAATGTTTCAACTGACCGATGCCGGATTTCCGTGGCGGGA
ATAAATGGAGACGCGGCCACCTTTGTTGCCTGTAGCTAAAAATTCACCTGTCCGGTCGTACTCAATGGCAGATATCACCTCGGCTGCAAAAGGGATTAAG
CAATGTGACTTAGCAATAGTTCTCCACCACGGCTGCTGTATGAAAGCTTTACAAAAAAACTTACCTTCAACAAAACTGCGGGCGCTTTCACCTGCAGAAA
ATATTTGCCCCCATTCTGCGGCGGCCTCACTGGTGCGTTCTGTCATGTTCACCTCCAACCCAGCGGTGGTTTGTTTTAGTCTGgaaagtgctgctgcgtg
gccGTCTTCTGCGCCAAGCTCTCCCCGGTGTGTAGTCTGCGTCATGCAGAAGCGAG