Description :
From Genome Similarity Track
Location :
Scaffold_117:72146- 79412
Transcript NameFunction/comments
Physo_142561hypothetical protein
Physo_109481glucose regulated protein /BiP

Sequence
7266 bases(100 bases per row)
ACCCAGGCCGTCCCATTGCCGTACGCAGCCTCCTTGGGCTTGACAACAGGCAGATGCTCGACTGCCGATGTGGGCGCCACCTTGGAGCGCGCCGGGGCGC
GCGTAAGGCGCGTGATCAGCCGCATCCGCATGGCTCCGGAGCTCTTCGTTGGGTGCAGAACACAGAGAACTGCAGCATTGAAGTGGTACATTGAGTTATA
ACAATGTGGGGATCTGTCGTGGCTGTTAAGAACATCATGTTGAAGTGCATGGTTAGTGTGTAACGGTTAAGTGCATCGCGTTGAAGTGGGAGAGTCATCA
ACCGCGTTGGTTGGTGCTGCGCGGAGTGTACGGGTTCACCTCCTCCTCGAACATGTCGGAGGCGAGCTTGGAGAGCGCGTGCATGGCTCGGAGGTCCCCC
AGCGAGATTTTGTCCCTGGCCTGGGCGTCGACCGTGCACAGGCAGGCAACGACGGCCCCGTCGGGCGACTTGATGGGGAACCCGGCGAAGAAGCGCACGC
CGATGTCGCGCGCAAGTCGCAGATGCCGGAGCTGCGGGTCGCGCGTGGGGTCCTTGACCACGAAGGGCTTGCCGTTGGCCACGAGTGGGGACGGACACAC
AATCATCTCCTCTGGCCATGGATGCGGAGCACCAGAGGACCCGACGACGCGTTGGGCTTGAGAGCTGTGGGCGCCGTTTAGCGCGACGATGTAGGCGATC
GAGCAGCGCATGCGCAGCGCTGCGACCTCGCAGATCGAGTCCAAGGCTGCAGAGTCCAAGCCGTCGTCCAAGTCGAGCTCCGTCTCCAGGTTGGCGCTGG
TATTCCACGGACGCGGCACCATTGACGGTCTGCTGCTCTGGTCGTACCTTACGGAAGAAGAATAGCCGCTAGTGCTGCGTCGGCGGCGCTGCGCGATGTC
TTGTCGGCTGTAGAGAGAGCTGGAACGCGCACGCGGCATGTGGCTATTGCTGCTGTCTGCACCGATGCTGCCGCCACTCATCGAGATGCTGGAGAGGTGA
AGTCGCGCCTCTAAGTACCGGTCCACCATTTCCTTGTCCGGATGCTGCGGGTGGAGGATCGGGACGGACGCGTTGAACGTCGACGAAGACGAAGCTGTAG
AAGCTGAGCTTGGTGGTGCTGAGTCGGACGTCACTTGCTTCACCACTTGTCGTACGACCTCGAGTGCTCGTGCACGAGTCAGCGGGTCACTGGAAAACAG
CGCGTCAGCGAGTTGTCGGCCTGGAGTCGAGGAGAAGGAAGTTGAGGCAGTGGCGGCGCTGCTGCTGCGATTCAGCCGCTTTGCACGTGGAGCGAATGAC
GTCTGCCTTGTTCTTGACCCTTGCTCCTCCACGCGGGCGGATTGAGTGCTGCGACTGTCTTCGTCGCTTCTCAGCAAGATGTCGTAGAAGGCGGTGGATA
TCTTCACGCTGGCGGCACTGCCACGCTCGTCGTTGCTGGTTCTGATCCCAGCCGTTGCCGCCGTCGAGGTCCTCGAAAACGAAGCATTCAAGAGCGGGTT
GTCTTGTTGGAAGACGCTGGCGTCTACGTTGGCCACACACGCGAAGCAAATGCGGCTGCGACGCACTCTGCGTGCCACAGGCTCCACGTCAAACTTTCTT
GAGCATTCGCGACAGACTCGGTGCGCGCAAAGCTGGCAGAACCGTTGTGGACGCAGCAACCCGAAGCGCTTGAGGCACACACTGCAGCAATGGTCTTCGT
CCTCATCGCGTGCCACGGGTATGTGCCGGAATGGCTGGTAGCCCAAACGGCGGCGGCGCACAAGCTGCTCGAACGATGTCGTCGCCGCCGCTAGCAGATT
CACCACATACTTTGCCTCTGCATTGGCGATCGGATGAGCGTACCGTCGAGCGGAAGCCCCATGTTGATCCCTCCCCCAGAACTTAGCGCGTGGCTGAACT
GTCGCTGCTGGTGGGCTGGAGACGTACGCAGTCATTACGATACGCGTCTGGTGTCCGCTCAAATCACTGTATGAGCTAGCGAGGTGATACCCAGCGGCGA
TGTGGTCCAAGTCGCCTCGAATCGCTTGGTCCGAAGCGCGGTCGTCTCTGCGACGAGTGAACTTGTCGTGCATGGGCTTGGACAGGGTCTTCATGGTGTA
GAACGCCTCGTTCGTGTCGGGGCAGTACTGCGAATACGCAGCGAAGCAGAGTCTCTGGCGGCGGCTGGTATGCTTCGCTGCTGCCATGGGATTCAGCGAC
CGACGAGAACGGAGCACCACGGACTGCAACGCGACCCAACCGGGTTGAGAGAGGTCGTTCAGGTCGTCGTCTTCCCAGCACGGCGCGTTCTCCGACTCCA
TCGCCATCACAGTCCTCATGCTCTTGCGGAACTCGCGCGATACGAACAAGTCGCCGCTCTTGAGCTTCCGCGCGCCGAACAGCGCCCCCATGCTCGAGTC
GAACTGCAGTGAGTCGCGGCTGAACAGCATCGTCATGGCCTCGTCCAGTCGGCAGCTTAGTGTGACGTGGGCCGATACAGCGTATGTGACGTTGAGGTCG
TTCAGAGGCCATCGCACCAGCTCCCTGGCGCGCACTTCGGAGTGCGTGTGCTCTCCCATGAAGGCGTCGCGAGTGTAGAGCGACCCACGAGACTCAATCA
TCGAGTGGCGAGCGTCGGTGGCCCTCGTCGTGCCGCGAAACCAATTGGGGCCGTCCGTGCTTCTTGCCGATGGTAGTTTGGCTCGGTCGAACTCACTGAT
CTCGGCGCCGTGCTGCTTCTTCTTGACGACCCAGCATGGCGGATGCTGTCTCTCGGCCGGTGTCATTCGCCACACGCTGCTGCTGCGGCCAGTGTCCTTG
CGGCGCTCCACAACGGCTCGGAGCTTGGGCACGACACTTGCTGCGGTAGTGAAGAGCTCGCGGTCGGTCACGAGGGCGTTGATGGAAGACTCAGACAGCA
GCGCGTTGCGCGCCGACACGGGCGAGGCCGCGCTGTTGTTGCTGCTCTGGAAGTCGCAGCTCTGGATGCTGCCGCGGCAGCTGCTGCCCATGTAGTAGCT
CTCCGTCATGGGGACCGGTGGTGTCGACGTGGTCTGTCGATTGGGGGGCGATGTCGGGCGCTCTGCAAATTCAGGAGTGAAGACGCAGGAGACCACCGAC
GCCATGTTGACGCATCCCGTTCGTCTCCTCCCAGGAGCTCAGCGAGCCGAGGTGGTGGCACCCATAGGAGAAGCAACCGGAGCTGGAGTGCACCGCCCAG
TGTCGACGGCTCCGGATGCCTGGTGCTTCCGCTGGCTTGATGCCCGGGGCCTGATCGATTTCGCCAGTGTCTGACACCGCTAGTTTACGGCCTCCGAGCG
ACGAGGCAAGTCGCACCTTTTTCGACGGTCCTTTGGCTGCCCAGAGTTGCTGATACATATCCTGCCTTGACGATTTTTTCGAGTTGGTGGCGCATTGTTG
AAGTTGTAATGCCGATCTTTGATCTTTGACGGCCACATGGTTGTCTTCGGGAATTCGGTCTCTAAGCTCCCCGCCAGTCATCACGACGCCGCTCTCCAAG
CATTTTAGAGCAATAAGCGGATGTTGCTAGACCGAATCTGCACCTCGGGCTGCCCGTCTTCTTGAAAGTTCGAGCGCGCGGTGAACCCAGAGCTCGTGGC
GTGTGGTGTGCACTGTGTACCACCAACCTCGATGGTTGGGATGAACACAGCACTGCAGTAGCTGAAGATGGAGCCCTTGCCGGCTCGGTCGTTACACCAG
GCGCGTCATTTGTAGCAGTTGCAGCGCAGTCGTCGTCCAACGTCCACTGGCCGAGCACTATCGGTGTCTGACCCCACTTCCATTGCCTTTACTCTCGGTC
GAGTTGTCCGCACGCAAGCCCCGAACATCCAAGTCATTTCGCTGCTTGGGTACTTCGACCGTCGCGAGATCGCCCCCGTGGGCGTGTGTCCACAACTTCC
AGCTGTAGCTGTAGCATATCGGAGCTCGTCGAAACGGAAGCTGGACGCCAGTCATCACGTCGAAGTTGCTGATGTTAAACCGGCTACGTATCCATTGATG
ACTGGCCGCTCGGGGTTTAGCTGCAACTCCGACTAACCGAAGCGAAAGCAAACACAAGGCAAAGCCTAAAAACTGAAGGAAAAATCACCTTACTTAAGTC
AAATAACGGAGACAACAAACTTCCAAATGCATTTACGCGATTCGGGCTGTTCGTCTACAGCTCGTCGTGGTCGTCGTCCTCCTCCTCGTCGTCGTTGTCC
TCGTCGCCCTCCGGGGCGGCGCCGCCCTGGTAGACCTTGGACATGATGGGGTTGACGAGCTTCTCGACCTCCTTCTGCTTGGCCTCGAAGTCCTCCTTGT
CGGCCTCCTGGTTGTCCTCGAGCCAGTCCATGGCGTCCTGCACGGCGGTCAGAACGGTGTCCTTGTCGTCCTCGTCGATCTTGTCCTCGAGCTTCTCCTC
GACGTTGTTCTTCAGGCTGTACAGGTAGCCCTCCAGAGCGTTGCGGCCGTCGATGCGGTCCTTGACCTTCTTGTCCTCGTCGGCGAACTCAGCGGCCTCC
TGGACCATGCGGTCGATCTCCTCCTGGGACAGACGGCCCTTCTCGGCAGTGATCGTGATCGTCTCGGCCTTGCCCGTGCCCTTGTCCTCAGCGGACACCT
GCAGGATACCGTTGGCGTCGATCTCAAACGTCACCTCAATCTGGGGCACGCCACGCGGAGCAGGCGGCAGGCCAGTCAGCTCGAACTTGCCCAGAAGACG
GTTGTCCTTGGTCATGGCACGCTCACCCTCGAACACCTGGATCAGCACAGCGGGCTGGTTGTCCTGGTACGTCGAGAAGGTCTGCGACTTCTTGGTCGGG
ATCACAGTGTTACGGTTGATCAGCTTGGTCATGACACCGCCCACGGTCTCAATACCCTGAGACAGAGGCACCACATCGATCAGAAGCACGTCCTTGGTCA
GGTCGTCCTGCTCGCCACTCAGGATGCCGCCCTGCACGGCAGCACCGTAGGCGACGGCCTCATCGGGGTTCACACCGCGCGAGGGCTCCTTGCCGTTGAA
GTAGTCCTTGATCAGCTGCTGCACCTTGGGGATACGGGTGGAACCGCCCACCAACACAATCTCATCGACCTCCGACTTCTTGAGGTCGGCGTCCTTCATC
ACCTTCTCGACGGGGCCGAGCGTCTTCTTGAACAGGTCCTCGTTGAGCTTCTCGAAACGGGCGCGGCTCAGGGACTCCGTGAAGTCCTCGCCATCCAGCA
GCGACTCGATCTCAAGACGAGCCTGGGCCTGGGCCGACAGGGCACGCTTGACACGCTCGGCCTCACGGCGGAGCTTCTGCAGGGCGCGCTTGTCCGAGGC
GACATCGAGGTTCTTGTCCTTCTTCCACTTCTTGATGAAGTACTGCATGATACGCTGGTCGAAGTCCTCACCGCCCAGGTGGGTGTCACCGTTGGTGGCC
AGCACCTCGAACACACCGCCGTCGATGGCCAGCAGGGTCACATCGAAGGTACCTCCACCCAGGTCGAAGACCAGCACGTTCTTCTCGCCCTGCGACTTCT
TGTCAATGCCGTAGGCAATGGCGGCGGCCGTGGGCTCGTTGATGATACGCTGCACCGTGAGGCCGGCAATGGTACCGGCATCCTTGGTGGCCTGACGCTG
GGCGTCGTTGAAGTAGGCGGGCACCGTCACGACGGCGTCGTACACCTCGCGGCCGATGTAGCCCTCCGAAATCTGCTTCATCTTGGTGAGCACCATGGCC
GAGACCTCCTCGGGGGCGAACTGGCGCTTCTCGCCCTTGACCTCCACCTGGATGAAGGGCTTGCCATCCTTGTTCACGAGCTCGTAGGGCAGCAGCTTCT
TGTCGGCCTGCACCGACTTGTCGTTGTACTTGCGGCCGATGAGACGCTTGACGTCGAACAGCGTCTTCTCCGGGTTGATCGTGGCCTGGTTCTTGGCGCC
GTCACCGATCAGGCGCTCGTCGTTCGAGTCCCAGGCGACGTACGAGGGTGTGATACGGTTGCCCTGGTCGTTGGCAATGATCTCGACCTTCTGGTCCTTG
TAGATGCCCACGCACGAGTAGGTCGTGCCCAGGTCAATGCCGATCACGGGGCCGCGCGGGCCCTTGGACGCGTCGTCGGCCGTTACGGCGCCGGCGAAGG
CCGCCGCCGCCATGAGCAGGATCTTGGAGAGGTTCATCCTTCTCTGCGCTTAGCTGCGAAAACGATAATGACTGGGGCGGGTGCAGGTGCAACGCGTGGA
AGTCAAAGATCGTGGGCGGGTCGGCCGCCTCAATACAGGCCCGCATACAAACTCCCAGTGAGCCGCCACTGCTGACGTGGCCGGGCGCGGGTTCCGACAA
AACGGGTCTTCTAGAAAAACCCGCCCAGAACTAGGCGAGTTTGTATGCCCCATACGAAACCCAAGTGAACGACTGCCACGCGTCGTCGGAGACCCCGCCT
AAGTGCGAAGATATGTCCGAGCGATCGACACGTTGCGGTGGAGAGATCAGTTGACTGTGAGTCGGACGAGGGGCAACACCGCTCGAATTTCGCTCGAAAC
GGGCCGGACCGAGCGCGTGGTTGCGGGCCTATCGACCTCAATGCCACATATTCACATTTCCATTGCGTGGCAGCAGTGCCGGGCAGGAGCTGCAGCCACG
TAGCCCACCAAGTTGATTCGTACTTAGCTGAGGGCAACACTCCACGTGGCAGGACGACAGCGCGAACCGGCGGTCGGCCGTCAAGCTCGCGACAGCGATT
TGCAATGCTGGTCAACCGCCTGCTGCGATCGGAGAAGGCTGCGGGCACGACTTGGCTGCGTCGACTTGCCTGCAGCGCGCTAGTCGACCCGTAGAAAACC
TGAAGGCGCCCGCCCAACTCAGTCGAGGAATTACCTTACTTAAGGTATCTTATCTTACGAACAGCAACAATTATTGCAGCGGTAAAGAAGAACGTCATGG
TGCCGTTCTGCGACGGCAGCATTGCAGTGCTAGAATGGGGGAACAGCGGAGAGACTTGCAATTGCGACTAAAAGTGGCTACAGTACAGTGTGTAGTTGCT
ACAGTAGGTTACAGTGCCGTCCGGACAACAAGTCGGCGCACAGCTTCTGGAAGACTCGCAGCTGGCAGCTTCCGCACACGTGGCAGAAAGAGGCATCAAG
GCGTCTCCACCGCCAGAAGAGTGCGATTGTGGTTATCGGAGCTCATTGACGACGTGTCAATCAAACGAAGCGGACCCCAGCTTCAACTACAGTGCCAAAT
TTGTGGTACGTTTGCAATTCATGCATTTCTCTGTCCAAAACTGCGTCGCTAGAAGCTCGCCACGAG