Description :
From Genome Similarity Track
Location :
contig_17:721451- 724248
Transcript NameFunction/comments
g4885.t1hypothetical protein

Sequence
2797 bases(100 bases per row)
GTACACCACACCCAGACGGCTAATAGTGGCGGGGGAAGCAGCACTTGTATCTGCTACTTCAAACAGCAACTGAATTTTTGGCAAGAGCTTGATTCGCTCA
CCATTGGCTAAACAGAGCGTCATGTTGTCATCCAGCACGGTATTCATACTCTCGATCCAGTGTACATCAATAGGGCCATCGAATGTTATCCAGTAAAATG
GGAGATTCCATGTTGATGGTTCACTGCTGACACCAATCGTTTGGTTAGCATAGTGGCGTGTTAGCATCTCCTCATTTTTCTCCATAATGCACGTACGTAG
CAACTTGGATGCGAGGCCGTCTGTCCACTCATGCGTTACAGGATGAAAAAATCCGTACAGCTCAACCATCGAAATCGACTTCGGGTTAAGAGTGTACGAA
ACCACGCGCTGAAACCGGACATCAGCGTGGGCTCTTCTTTCGCGCAGTGCAGTCACTGCGGACTTCAAAACCTGTAGTGCTGTACTCTTCCCACTGCCAG
TAGATCCGGTCTGAACAACACCGATGCGTACCTCTAAGGTCGCAAACAGTTGCAGCAACTTTTTTGTCCATTGACGAGGTCCTTGGAGATGACTTCGTCG
TAGCTGTTCATTGATTTCTTCCTCTAAAGCAAGCATCCAGTTTGTAGCGCCAGGTGTAGGCGATGGGGAAAATACTCCAACTCCCTCGAGAATCGCACTA
CTTTCACTGGCGCCTATGGCTGAAAGGGTATCTGGGAAGAGATCTCTCAAAATTCCTTGAAACAACTGACTGTCATTGTCGGTGAGCTTCGGGGTGTTCG
CTCCGACCATGGCTTTAATCAAAATAACGTTTTCGTCACTGCAACTGTCAGGTGCCGATTCATGAGACGAGGTGGCCTCTGGCGTAGGAGAAGAAACAAT
TGGTGTCGCTGAACGTTTAAGAGTGCCCGCCATCGTAAGAACTGTTCGTACAGCCCGCATACCGAAGTCGTAGTGAGGCTGCTGAGATAGTTGTTCACTA
CAAAGCTTATATAGCTTTGTTACTTTCTGGACAGCGGCTTTGCAAGCTGGAACCCTTCGGCAAATAGCAAGATTTCAGCGATCAAAGCATAATCCGGTAC
CATCATTGCGACTGGCCGGAACGATACTTTCAGGTTGTCAGGTAGCTCGGTGCGTCCAGCATAACCCGGGTTCATTGTAATTATTACGTGGTGGTCACGC
AAAGGAACACATTGGCCGTCTAGGAGCACCTCAGATAAGTTCATCAGGCGCGCGTTCCTTAGTCTCGACATTTGCTGCCCCACGACTGAAAGTACTTCAA
TGTCGATGCGGTTGAACTCGTCCAAGCATACCCAAGTTCCTGCTTGAATTACGCCATTAAAAATGCTCCCCATCATTTTGTAGCTCATCTGGTTGCTGCA
GTTAATCACAATACACCAAATGCCAAGCGCTTTCGCGAGGTCCTTCGATGTCTCAGTTTTTCCTGTTCCAGCAGGACCAGAAGGAGCTGCGCCGTAACGC
AGCTCAAGTGCTCCCGTGATCGTCATCCAGCATCGATCTGTTAGGGGGGTAATTACGAGGCGACTACACGCACCCATGTACTCGTATCCGTACTTGATTC
TACAGTTTGCTTGGAGAATCTCACACTCATCAGACTCGGCGTGCCATTGATATCGAAGCTGCTGCTGCCACAGAAGTCATTCGTCTGTAACGCGCTTCTC
CACCAAAGACTCGACAATATCGCGCAAGTGAACATCCGTCGTCACTAGAGACACAACTACGCGTCGCTGAACGGAGCTTAAAGATGTTCGCACTAGGCGA
GTCAAATTGCTTAACTGCGTGCAAATGGTCTGGTGCCAAAGAGATAGTTCTCGAATAGGATCTTGTGACCGTGAGCGAAAGCAAAACTCGCACTCTTTCG
CCCAAATTATGTAGATATCACTGCAACCGCTTGCGCGGGGTGACGAAAAATCCACGTCTCTCTTGAAGAATGCTGGTAGTCCGACAAACAGCTTTTGACA
TGTTTATGAAGGGTTGCCTTCATGTTGATGAGGACAGCGTTCAGCCAATCCTCAATATTACCGCGGGCTTTTAGTACTCGCCCAAATGTGACCCGCTCGC
CTTCCGGACTGATCATCGCAAGGATATCATGCGAGCTCAAACCCGATGCGGCTGTACCGGTATGCACTCCGTCATCATTTATATCTAGCTTTACTAAAGC
ATCAAAACACTTGGGTAAATGGCGCTGTACCACTTGAGGTTCCTTTGCATGTGCCAGCATTTCCAATAACTCATCATTTGAAATGAAGAAAAAGCGCGGG
AATGCCCGCCGCTTCATTTCAAGGTAGTCTTCTAAAGATTTTTCAATTCTTTCCAGTGACGCATTGTGCTTTGTGAGGCTGTCAAGCAGTGCCTGCCCGA
CACCACCAGTGCCACTGCTCCCAGTGCTACTGCTATTACCGTTGTCCTTGTAGTTTTTGGAACCACTGGACGCACCGATTAGTATAGCTCCCGTTACTTT
CAAGCAGCTTCGCTGATCTCGCGTTCTTCGCATCAAGTCTTTCCAGAACTGGTTAATGCCTAAGAAGGTAGTACCTTCATTAGGAAGTTGCTTCTGGATG
TCGGGTGCCGAGAAAATTGTCTCGAGATGCATCCATTTTCGTTGACATTCGATCCAAGCATCGAACGTTTCTTGAAACAGGAGCAATCTTTTGTGCCACA
TGACTGCTGTGTCTTTGATGGGGGCAATGAACTTAGAGCTCAACACCGCAGTCAAATTCACCAATGATTCTTCTAGTGTCGTGTAAATATTCTCGAG