Description :
From Genome Similarity Track
Location :
contig_29:72140- 74156
Transcript NameFunction/comments
g6733.t1XP_009519809.1 hypothetical protein PHYSODRAFT_325631 [Phytophthora sojae
g6734.t1hypothetical protein

Sequence
2016 bases(100 bases per row)
ACCACCGCTGCCAACGCCGTCGCCGCGGCGTCCGCGCGGCTCTCCATGACCGCCGACTCCACCAAGGCGCTGTGGGACGGATTCTTCCGGGGCGCCGAGA
AGATTGCGCGGATCTCCACGCCCGAGCCGCACAAGCCGGTAGCAGTCGCCTCTGAGCGCACGCCACTGCTGCTGTTCGACGCTACGGTGGTGCCCAGCAA
CGGCATCAAAGACGAGGAAGCGTCGATCACGCGGTGCATCAAGAGACGCCACAGCAGTGAGGGCCAAGCTCTGCTGCGTCTGGCCTTCCAGATGCTGCTG
TTCGCCGTCGTGGACTTTGCGCCCAACTTCCTCAGCGGCGTGCTCACGGGCCACCTCAGCGCCGCGCACAGCAGCGAGTTCATGGCGGCGCGCAGTCTGG
CGCTCATCTTCAACATGGTCACGAGCACGACGCTGGTCGCCGCCATGAGCGCCGCCATGGACACGCTATGTGCCCAGGCCTACGGTGCCGGCCAGCTACG
AGAGCTGGGGCTCTTCTTCCAACGGGGTTGCTGGTCTTCGCCATTGGGTTCCCACCGGTGGCGCTTGCCAGCTTTACTGCGTCGAGCTGCTCGAGTTTGC
AGGTCAGAGACGCGAACTCGCCCAGTTGGTTCACAGCCTCGTGCTGCTGGCACTGCCTGGGGTGCCCTTCACGGCTGTGAACGCGCTCATGTGCAAAATC
TTGCAAGGTCAGAGCAAGGTGGAGCCCCTTGTGGGCGTCGGGCTCATGGCCAGCGTCGTGCAGGCGACGCTGCTCTATGTCTTCATGTTCCGCACGTCGT
TGGGGTTCGCCGGCTCAGCTCTCGCTATCTCAGCGACCATGGCCTGCTACGCCGTCGTGCTGGCGACGTACTTGTACCGCAGCGGTCTCTACCAGCGCGA
GTGGCCAGGTTGGCAGTTCTCGGAGGCGGTTCGGCTCATGCCCGAGTTCCTGCGTTTGGGTGTGTCCGGAATGGCCATGTTCGTGTGTGAGGTGTGGGGC
TTCGCGGTGGTGGGACTTTCCTCCGGGATGCTGCCCCACGCAGCCGCCGTCGTGAGTGCAGACTCGAGCTACGCCAGCCTTCGGTGGCTTGGAGCACTCT
GGTACGCAGCCATCTCGCTAGCGGGCTCTGTGAGGGTCGGCAACGCGCTAGGTGCTAATGACCCAGCGCGTGCCTGGCATGCAGCAAAACTTGCTTTGGG
ATTAAGCACGGCCTGCGCCCTCGTTGCTTCGGTGGCGATGCTGCTACTCCACGGTGTGTTGCCCTTCGCATTTACGAGCGACGAGCGGGTCGTGTCAATC
ACGTCCAAGCTGTTACTGGTGACCAGCCCACTGCAGGTCTTCGCTGCAATCTCGTCGGTGTCCCAAGGCATTTTCCGTGGGTGTGGCCTGCAGTCGCTCG
GCGCGAAGGTCAACTTTGTCTGCTACATCCTGATTGCTGTTCCGTTGGGGCTCTTGCTTGCTTTCTCGTTCGAGATGGGGCTGCTGGGACTCTGGCTCGG
GTTAAACGCCGGCTTCATCGCGAGTGGGCTCTTCAGCACGTACTGGTTGGCCTTCCGAGCAGACTGGCCAATGCTGGCGTACCAGGCAGTGCAGCGGACA
ACGTGTGGAGTCCCAAGCAACGATGAGGATAAGAGTGGAGCTTGCTACCTACCGTCGCCGATGGCCGTGCGAGACGTCTCGTACTCGCATGAACCTATGC
ATGAGCCCCATGCATACACTGATGCCCTTCGACCGTCCGAGGGTCTCATATGAGGCGATGGGCAATTTAACCTAAGAAAGACAAGAGTGCAGGATAAAAT
AACGTGAAGTACCAAAGTGAAACAACTATAAATCCTGCTTAGAACTGGTAAAGAGAGATAACCGTTTCCCCCAAATTCGATACCTTGAGTTGAAAACCTA
TTTACAAGTACGAAAAACTTCACATGAAGTGATCGTGGAATGCTCACGGTGACTTCATCCAGGACCCCTTAGGCTGTCACAGCGACGTCAATCTCAACTG
TGCCATCACATTCAGT