Description :
From Genome Similarity Track
Location :
contig_29:72138- 74154
Transcript NameFunction/comments
g7054.t1XP_009519809.1 hypothetical protein PHYSODRAFT_325631 [Phytophthora sojae
g7055.t1hypothetical protein

Sequence
2016 bases(100 bases per row)
GCGGCGCCACCACCGCTGCCAACGCCGTCGCCGCGGCGTCCGCGCGGCTCTCCATGACCGCCGACTCCACCAAGGCGCTGTGGGACGGATTCTTCCGGGG
CGCCGAGAAGATTGCGCGGATCTCCACGCCCGAGCCGCACAAGCCGGTAGCAGTCGCCTCCGAGCGCACGCCACTGCTGCTGTTCGACGCTACGGTTGTG
CCCAGCAACGGCATCAAAGACGAGGAAGCGTCGATCACGCGGTGCATCAAGAGACGCCACAGCAGTGAGGGCCAAGCTCTGCTGCGTCTGGCCTTCCAGA
TGCTGCTGTTCGCCGTCGTGGACTTTGCGCCCAACTTCCTCAGCGGCGTGCTCACGGGCCACCTCAGCGCCGCGCACAGCAGCGAGTTCATGGCGGCGCG
CAGTCTGGCGCTCATCTTCAACATGGTCACGAGCACGACGCTGGTCGCCGCCATGAGCGCCGCCATGGACACGCTATGTGCCCAGGCCTACGGTGCCGGC
CAGCTACGAGAGCTGGGGCTCTTCTTCCAACGGGGTTGCTGGTCTTCGCCATTGGGTTCCCACCGGTGGCGCTTGCCAGCTTTACTGCGTCGAGCTGCTC
GAGTTTGCAGGTCAGAGACGCGAACTCGCCCAGTTGGTTCACAGCCTCGTGCTGCTGGCACTGCCTGGGGTGCCCTTCACGGCTGTGAACGCGCTCATGT
GCAAAATCTTGCAAGGTCAGAGCAAGGTGGAGCCCCTTGTGGGCGTCGGGCTCATGGCCAGCGTCGTGCAGGCGACGCTGCTCTATGTCTTCATGTTCCG
CACGTCGTTGGGGTTCGCCGGCTCAGCTCTCGCTATCTCAGCGACCATGGCCTGCTACGCCGTCGTGCTGGCGACGTACTTGTACCGCAGCGGTCTCTAC
CAGCGCGAGTGGCCAGGTTGGCAGTTCTCGGAGGCGGTTCGGCTCATGCCCGAGTTCCTGCGTTTGGGTGTGTCCGGAATGGCCATGTTCGTGTGTGAGG
TGTGGGGCTTCGCGGTGGTGGGACTTTCCTCCGGGATGCTGCCCCACGCAGCCGCCGTCGTGAGTGCAGACTCGAGCTACGCCAGCCTTCGGTGGCTTGG
AGCACTCTGGTACGCAGCCATCTCGCTAGCGGGCTCTGTGAGGGTCGGCAACGCGCTAGGTGCTAATGACCCAGCGCGTGCCTGGCATGCAGCAAAACTT
GCTTTGGGATTAAGCACGGCCTGCGCCCTCGTTGCTTCGGTGGCGATGCTGCTACTCCACGGTGTGTTGCCCTTCGCATTTACGAGCGACGAGCGGGTCG
TGTCAATCACGTCCAAGCTGTTACTGGTGACCAGCCCACTGCAGGTCTTCGCTGCAATCTCGTCGGTGTCCCAAGGCATTTTCCGTGGGTGTGGCCTGCA
GTCGCTCGGCGCGAAGGTCAACTTTGTCTGCTACATCCTGATTGCTGTTCCGTTGGGGCTCTTGCTTGCTTTCTCGTTCGAGATGGGGCTGCTGGGACTC
TGGCTCGGGTTAAACGCCGGCTTCATCGCGAGTGGGGTCTTCAGCACGTACTGGTTGGCCTTCCGAGCAGACTGGCCAATGCTGGCGTACCAGGCAGTGC
AGCGGACAACGTGTGGAGTCCCAAGCAACGATGAGGATAAGAGTGGAGCTTGCTACCTACCGTCGCCGATGGCCGTGCGAGACGTCTCGTACTCGCATGA
ACCTATGCATGAGCCCCATGCATACACTGATGCCCTTCGACCGTCCGAGGGTCTCATATGAGGCGATGGGCAATTTAACCTAAGAAAGACAAGAGTGCAG
GATAAAATAACGTGAAGTACCAAAGTGAAACAACTATAAATCCTGCTTAGAACTGGTAAAGAGAGATAACCGTTTCCCCCAAATTCGATACCTTGAGTTG
AAAACCTATTTACAAGTACGAAAAACTTCACATGAAGTGATCGTGGAATGCTCACGGTGACTTCATCCAGGACCCCTTAGGCTGTCACAGCGACGTCAAT
CTCAACTGTGCCATCA