Description :
From Genome Similarity Track
Location :
contig_85:72133- 73485
Transcript NameFunction/comments
g12323.t1XP_009536912.1 hypothetical protein PHYSODRAFT_340450 [Phytophthora sojae

Sequence
1352 bases(100 bases per row)
CATGACGGTCAAGCCCTACGGCCCGGCTGTGACCTGGCCATGGCGCTCAACTACGTGATCGGCACGGGCTGCTTCGGACTGCCCTACGCCTTCATGGAGG
CCGGCATCGGACTCAGCCTCACGCTCATGATTGTCGGCGTCATCGGCTCGCTCATCACCATGAACTACACGCTAGAGTCGCTGGCCAGGGCCGAGGGCGT
CTGCGCGGCCACGGGAGGAGGCGCCCCTCGCCATCAGATCACGTACCGCAAGTTCGAGTTCGCCACGATCGCTGACATGTTCGGGGCGTGTGGGCAAGGC
CGCTGTGCAGCTGGTCATGGGCCTGTATTGCATCGGCTCGCTCTGGTCGTACGCGTCCGTGTTCTCGTCGTCCACGGCCTCGCTCTTCTTCTCGTACGTG
CTGGGCGATTCGTGCGACGTGTACGGGGATTCGCCCTCGTCCGGCTGCCTGGAGGGCTACTACGTGTTCATGGCCATCTTCTCCGCCATTGTGCTGTCCA
TGGTGCTCATGGACATCAGCGACCAGGCGCTCGTGCAGAAGTTCCTGTCCGTGTACCGGATCGTGGCCTTCGTGCTCATGCTCGTGACGATGCTGGTCAA
GGTGGCGAGCGACGGACAGGACATTGTGGCCTCACGATACAATGCAATCGGCCTGGTGAACTGGGGGAACTTTGGCAAGGGCTTTGGACCCACACTACTG
GCGCTCAACTGCCAGTACAACATGCCGGACGCGCTGCAGCCGCTGAATCCCAAGTCCAAGGCGCGTTTCGTGGCGTTTGCTGCGCTATTGATCGCTGGTA
CGTGCTACCTTCTGGTCGGCCTGCTCGGGGCGCTGTCCTTCGACAAGATCAACCCGCTGGCGACGCTCATGTGGAGCGATTACACGGGCTGCGGCAACGG
ATGGGAGCAGTGCGGCCACGCCAACCCGGGCGGAATCGTCGTGCAGCTCGTTATCCTGCTCTTCCCCGTCATCAATGTGGTGTCGGCGTATCCGATGGTG
GGCGTCACTGTCGGCGACAACATGCTCATGTCGTTCCCGTCGCACCTCACTGCTCGCTTTGGTGAGGGGATCACACGCAGCATGTGCCGACTGTCGGTGG
CGGTGCCGCCGATTCTGTTCGCTATCGTGTTCAAGCGCCTGGACTTCATCTTCGCGGTTGCAGGACTGTTCGGATTCCTGCTCGGGTTGACGATTCCGTG
CTGGTTCCAGGTCATCGGTAGTCGCTACTGCCAGCGCGTGTGGGGGTTCCCTGGCGCCGCCATCACCGAGTTCACAGAGCCGATTGTGAGCTCCGTCCCG
TTTGCGAGTGTCTTCCTGGCCCTCACCTTCGTCATTACTGCAGTCGCCATTG