Description :
From Genome Similarity Track
Location :
Scaffold_24:72127- 78076
Transcript NameFunction/comments
Phyke_g1570hypothetical protein PHYSODRAFT_555666

Sequence
5949 bases(100 bases per row)
TCGTCCAGTGATCCTCTAGCTGGGACACACGCCTCCTTCGCACCTTACGCACAAGGCCTTGTAGGTTACTATGGAGACCCCAGCAACCCAACAGCCGAGC
GCTTGAACGAAGGCTCACCATACTCTCCTGATACCCCTCGAATCTTCTTCAGTGCAGCTCTACAACGTACGGAAGCTAACATATTGATTATTAACTATGG
AGGTTAGAATGTTATTGTACTTAACGTATTGATATTGGTTAGAAATATGTCCTGGGATGGTGGGGCCAAACCATAACGGCGAGTTCTACTGCCACAGTCG
CGACTACGGCTACTGCGACCGACGCAGTGGACTCTGTGTCTGTAACCAGGGCTATACAGGTCTTGACTGCACAGTCTGCCAGCCAGGATATTTTAAACAG
GGCAGTCTCTGCTTCCCGAAGAGTTAAGGACCTTAGCAGTATTTTGTGCATTTTTCTGATCATTTAGTGAGTCTAACTGTGGATATTGTAAGCAGAAAAC
TGTCCAAATGATTGTTCACGTGGAGGAGAGTGCAATTATGCGACTGGAATTTGCTCCTGTGGAGTGACTCGACGAGGTGCTGATTGCTCACAAAGAGTTT
GCGCCTTTGACGAGCGATgtgtgagctgcacaagcaaGCAATGTCTGCGTTGCACGGAAGGTTTCTATGTGGAACCTGCTAATCAGACCTGCGGTGCGTT
TTGGCAGAGTACTTGTTGTCAGTGTATCTGTGTGGATTGACGGCatgattgttgttgttgagcaCTGAGTAGTATCCTGTGCGCGATACGATCCGCGGTG
TTCGAGCTGCAAttcctcttcttgtcttACATGTGCTGATCTGCAGTTAAATTCTGTGCGTCGCAGCGGCCCACGCAGAATGGATCCCCCACTTCCTGCC
GATGAATTATCGCGCGAGTTCTCGCAAAAGTTCGTTTACGGCAGCCAAGACCCTCGTGTGTTCGATGAAGCTGAACCATACACGCTAGTTCCAGCGTCCG
CATCGTCTGTACCTCTCAATGAGAGCAGTCTTGCCTGTATTCAAGGTGACAATCGTGATGCAGGGTGGACTTGTTCATCATTTGCTGAATCACATCGCGT
TTGTGGTCATCGTGGTGTTTTCACGTTTGCGTCGCCAATTTACGCAATCACCGAAGCCGCGAAAAGCATTACGATAACAGTGCAGCGTTCCGGAGGCGGA
CTTGGCAGTGCAGCCCTTCTGTATGATCTACAACACGTAACTACCTCACCTGGAGACGTGTCCCCCACAATGTACTACACGGGTTCGCAGAAGTTGGTCT
TCGCTCCAGGTGTTATTTCACTCGCtttcaagctgcagattCTCGACGATCATATTGTCGACGGTAACAAGAATTTTCGACTTGTCCTTCGTGAGCCATT
GGCTCCTTCGGACTCTTTTGCAGTGCCGTCGGCAACTTTGGGGAATCAGTGGCGCACATTAGTAACCGTTCTGGATGATGACAACCTTCGACCAGTGGCG
AATGTATCTTATGTCGTTAGTCCCGAGACCACGCTAATGAGCGGGGGCGCTGCTGGTGACCAACTGACATTTCAGATCCAGAGTGTTGTAGGCAACGGCG
CACCTGGTGTGGATGCAGTCAATGAGGCTGTGTTTCTCATGTTTTCGTACATCGAAGAAGATGCTACTAGCTCTGGGCCAGCGATTTATCGCAGGCTTCA
GTTTGGAGTCATCACGCAGAGTGGGGCAACGCTCAGTTGCATGTGGCAGCGCAAGCTTGCGGGGGATTACACAGTTGTTATTCAACTCCTATATCCTGGT
GGTCTACGAGGCGAGTACTTTGGCGACGCGTGGCTTGGGGAATCGTTTTTTGATTCAGGTGTAGCTACCCCCGCCGTATCGCGTATTGATCGTCATGTAA
ATTTTACGTGGAATGGGGATCCAGCATTTCCAGGCGCTCACAGTCATTTGTCGGTGCGTTGGAGTGGGTGGCTTAAACCTCTCGCCTCAGGGCCAATAAT
GTTTGCAGTATCAAGCGTTGGTTACGCTCGTCTGTGGCTCGACAATGTTTTAGTGATTGACAAGTGGGGTGCCGGTGAGCATAGCGGCGAATTGCCTGTT
GTCAATACGGCGGCAGCCGTGAGTTTAGACATTTCTCGCTACTACGCTTTGGTTCTGGAATATCGGGCACCGAGGCGTGGAGAAATTTATGCGCGTTTGC
TGTGGGGAAGCGTGGGGAGTACCAAGATGAACATCATCCCAGCCCAGCAATTTTTTTCTGCCAGTCATATTCAGGGCTCTCCTTTTGCCAATGTCACAGT
GACGCCAGCTTTGAGTGCGAGTGCAGCGTTATCGACTTCGACCCTGAGAAGTGGTGCTTCATCTGCACCTCCTGCTTTGAAAGTGACTGCAGGAGACAAC
TTCATTTTCAGCGTGTTGCCACGTGACATCTACGGCAACCGACGACGTTCAACAGATCAAGATAGCGCCAAGCGTGacaccattgctgcaagTCTAACGC
TGGTAACTGACAGAAGTCTCGGAGGTGTGGGCACCAGTGCAGCAGACGGCATAATCACGTGGAACTCAAAAGATGATGTTTTTCGCGTAACTGCAAGACC
TCAACGCAGCGGTGACCATGCCATGACTGTGCGAGTCAATGGCATAGCGTTGGCCGGCAGTCCTTTCACCGTATCTGTGACTCCTGCACAACCCAGTGCT
TCATTGTGTAAACTTTCCGGCTCTGGTCTGCTAGCTGGTCGCATCGCCGGCCAGCCTGTCACTGTCCTGCTTGAAACAAGAGATTTGTATGCCAATCGCA
TCTACACTGGAGGAATTGATCAATTGAAACTGCAGGCTTTACgctcatccagcagcactttgccgATTGTAGTAACGGGACAGATGACTGATAATTTGGA
TGGGACCTACACGTTCACGTACACACCTCGCGTGGTTGGCAGCTATAGCGTTGCAGTCACGTGGAGAAACATGCATCTGCATAACAGTCCATACACCGTT
ACCGTCATACCCAGTTCACCTGTGGGCCCCACTAGCAGCGCTCGTGGAGCGGGCATCACTTCTGCGCAAACGAATGTGCAAGCCACTTTCGAGGTGACTA
CACGCGACTCGTCTGGCAATAATGTTCCcagcggtggtgctgcttcgcTGTTAACGGTGGTGCTAGAACATCCGAAAGGGAATGTGAGTGGAAATTCGTG
CACAGACCTACTTAATGGGCATTATACCTGCACATACACCGCGCACTTCGTTGGTTTGACGCGGCTTCATGCGCTACTAGCTCAACGAGAGCTTAAGGGG
AGTCCATATATCGTGGATGTCACTGCTGGACCAGCTCTGGGCTCACGCTGTGTGGCCACTGGAGACGCACTCGTTTCTACAGTTGCTGGTCAGCGAACCA
ACTTCACTGTCAGTATTTATGATGCGTTCGGGAATGCAAAGTCTAACACGGGCAGTGAAAATATCGTAGTCATCTTCAAAGGCCCCGGGGCGCTTGTTTC
CACGGTTGCCAGCGCTGAAGTAGCAATGTCTtatgttggtggtggcgtgTTTCTCGTGGCGTACACACTGAATCTCAAAGGAATCTACACGATAAGCGTA
ACGGTGGATGGAGTCGCTGTCATATCCAGCCCCTTCACCATGTACACGTACCCTGCTACAGCATCACCTACTACTACGTCGTTAGATTTGATTACTCCAG
CGCTCCCGAGATCGCAGGCCGATCCGCCTGTCGTCTTCATAGCCGGTGCGCTTATTGAGACCAGACTCACCACACGGGACAGCTTCGGAAACGTGCTCGA
GACTGGTGGCAACTACTTCCAGCTTGACAAAGCCGTACGTGCCTTCCTCAATGTGCCGATTGTTGACGAAAAGAACGGGAGCTACCTCATCACACTGCGG
CCGACACGCAGTATGCTGTTTCCTTTTACGCCAAAATTGATGATGCCTGGAAGTGTAAATGCTTCATACTACGCCGCAAACGCTGTGCCAGACACCGCTG
ACCCAGCACCGAAGAACTCTTTGCTGGAATTACAGCGGCACGACCCATCCATTAATTTCGACTTCGGTGATCGACCACCTCAGTATGTACAATCTGCGGG
AACCTTCAGCGTACGTTGGGAGGGTTTTCTGCTTCCCCAGTTCAGTGAGATCTACACTTTCGAAGTGGAAGTTATGGGTCTAGCTAATCTTCGCGTTGGT
AGTGCCACAGCTGCCGTCACTGCAGGTGATACGAGCGTGTCTGTCAAGGTTCCTCTCACGGCTCAAACTTTTGTACAACTTGagctcaacttcagcaaaC
CACAAGACCTACCAAACGCTGccgtgcagctgctgtggagTAGTCTTTCTCAGGCACGCGAAGTTATTCCGTCGTCTCAGCTATTCACCTCGTGGGGGAT
CGTCAACAATGTACCACTACTTGATGTGAAGCCCGCTCTGGCAGAGCCTACAGCTTTCACCGCGGAGTTTGCCAGTGCATGGCTGCCTACTTCAGAGACT
GTACAAGCCGTGGTCGATAAGCCATTGATATTCATCACGGTGGCACGTGACAGATTTGGAAACAGGCTCAGCGGTGAAGACTATTGCACGCTCTACGTGA
AGCTTCCGCAAGTACCACAAGGCAGCACCCAACCCGATCTCGTGATTACCGACCTACTTGACGGCTCTTACAAGGTCTTACTGACCCCTCACCTGACAGG
AATCTTCTCATTCCTCATTGCTGCACTTCCGGATGCGCAGAAAGCAAACGCTCCTGCTGGTGGAGCGTCATTGGTGAGTTTTCTGAGTACTTACAACATC
AAGGGCAGTCGTTTCAATCTTCAGGTAGACCCTGGATTGCCAAGTGCGGCGATGACTACACTTATTGGAGGCGGATTCGTGACGGCTACTGCTGGAAAAC
GCACGGCATTCGCTTTGGAGCTCcgcgacggcagcagcaacctaCTCACAATCGCCATGATAACTTCTTACCTCAGTCAAATTCAAGTCAAACTCAAAAG
TATTAGCAAAGGTATTGAAGTACCTGCGAACGCCTCACaagttggtgaaggagacCTAGATTTTTTTTCGGGCCAAGAGGTGCGTGTAGAGTACACTGCA
ACGCTTGCTGGTTTGTACGCTGTCCTGCTAAGTGTGGATGGTGGGACTACATTTGCGCAAAAGACCACGACATTGAATGTGTTCCCCAACGTCGCCACAG
CAGCGACTTCCTTGGTCTCCCCTAACGGTGTTGGGGCAGCATCCACTGGAGGGGGGTTGGGCCCGCAGATTTCCACGAACCAGGGATATACCTACCACGT
TACAATTCGCGACACCTTCGGCAATATACGCACTAGCGGCGGTGACCTTGTTATTGTGCGCATCAACGGTCCCGACAACTTGATTGGAACCATTACTGAC
CTTAGCAACGGAGACTATGTCGTGGCCTACCATGTGGCACGTCCTGGGCCGTACGAGATTCAAACTTTGATCGCTGAACCGGGACGTGGGCTCATGGGAT
ACTACTACGTGGATGCAATATCGGTGCAGCAAAACTTGCCCAGTGCTGTGCGTACTGTCGACGCTATAATCAACTTCGATTGGAGCACGAACGCCACAAT
GAGAGGGTATCCGCGAATTGTCTGGCGAGGGTTTTTACGTCCGTTGTATACTGAATACTACACGTTTAGTGTGCAGCGGGGGGTTGGCAGCGGAGCTGGG
ATTTCCATCGGTGGTCAGACAATCATTGACGGTATGAACACTGATGCGACCTCAGGACTCGTTGGACTGGTCGGTGGAAGACTGTACGCCATAACTGTCG
AGTATCGTAGCGCCTCCACACAACAGGACCCAGGGTATTTATCGCTATATTGGAAGAGCAATCaacagaagatggagatcaTACCGAGCCAGGTATTGAT
TGCAGAGGCTAAAGAAATATTGCCGCGGACGCAGGTGGTAGTAGTCTGA