Description :
From Genome Similarity Track
Location :
Scaffold_31:72103- 74043
Sequence
1940 bases(100 bases per row)
ATAAAATGTGCTAACTTGCTGGTACTTCAAGCAGACGCTAGCGTCCTACCGTGTCTTGCTCAATTATTGTTGACCACGTGTTATAGTTTCGTTGCAGTTA
CTTTTGTTGCAAAACGTCTTATTCACACGCATCACAATTTTTCGACCCTCTTACCCGCTGTAATGAAGTGAGGCAGTAGCCGCGCCCTCTGGTGAATGAT
ATTGGTAAGCATCACCTGAAGCTTTTCGGCCAGAACTGACTGCAAATGACAACAGTCCCTTAGTGCTCTCTTCGATTCATATGGCAATCCGTGTGGCTGC
TGAGCCTACACGAGTAGCAAAAGGTCACCTTTCCACATCCGTATAAACAATACCCATGCACACCTACATGTATGCCAACAGATGCGTCGCGCATCTTGGA
CATAGTCTTGTCGATCGCCCTCTGTTGACATACCGGGTGGCAATGTGACAACTTTCGTCATCGACGCACGTTTTCTAGTCTCCCATCTATGCGTCGCTAC
ACTCTAGATGTAATCGGTTGTAGACAGTCACCTTTTATATCGTCCGTGGGCTGGCCGGTTTGCTTCTTCAGATGATTTTTGCAGCAAAGAACGAAGCCAT
TGTCTACGTTGACACTTTCAACTGAGCAAGGACAACCGACGCGATGACGGACAAAACGTTGGTCGTTTACGAGTGTACCAGTTCAAATTGGATATGTAAC
ACTTCTGCGAGCTAAACACACGGTATAAATGCTTTTCCAATCTAAGCCACACAAGTCGAATCTCGAGATTGACAGCATGGTGAAGCACGACTTTTCGATC
GGATGATGTTTCCGCCACATACAGATTGACTGTTTGAGTCTAAACTGAAGAGCGCGTTCGTGACGATGCGAGATTGCGCGGTACTGAAGTATGCTTACGA
TCGAACAAGTGTGTGTAATCGGCTTTGTGATGCCCAGTACTTTGCGTAGCACAAACGCAGTCCTAGTAATTTGGTCAGTAGTCATCTTTTTAGACTGATA
GAACGTCGAGATTTGGGTACCTCAATATTAACGGCACTCGGATCTACGCATTGGTTGAACAAGTAGGAATAGCAGATCTGAAGCCCTCACTTCTTGCAGT
GATGTCCTCTTATTTACGTTAGAACTGCTCAGAAAGTGCCAAAGACGCTCAACTACAATCGACAATCAGACAATCGTGCTGTGTTGCAGGTTACATGCTA
TACAAATTGAAGCTTGTCATGGTGGTGCGGTGTATCATAAGCACACAAAGCAATCATCGGCAGCGCTGGAATATCTTGACGAAAGGCTCTATACGAAGCA
ATATCTCGTCCACGATCTCGTCGGGTTGACCAGATACTAGTACCCAAACAGTCTTTGACAGTAACTCGGAGAAATCCCACGTCTGAATTGCTACAGACGA
GAAATTAGAGTCGAGCATACCGGCCTACCAATTTTTTGTGGTGGACTCATTAGCCTCGGAATGAAAATCGAATGATTTAAAGACGAGGAACTCACGGAGC
TGAGTTTCGTTTGGTTCTAGTAGTTGAGGACGGAGTCTGGTTACGCCGCGTGGATTCATGTCGAAGAGAAATCCGACTGTGAGGAAGCCATATTTCGCAA
ACACACCTTTGAGATTCGTCCGATGTCAAACCATCAAAAGCTTTAGCTACGCTGCTGAAATATGTAACGTTGCGCCCAGTCGATTGTGGGGTTTCGATCT
ATTTTATTGAATGGCATTCTCGAAATGCCGTACGATAAAATGCGTTTATTGTCGACAATCTCCGAGTATGACGGTGCGTCTTGCAACAGGTGCATCCTTA
ACAGCGATAATATAACTAACAGGACTGTATTTGTAACGGGGTGAGCCTGTTACATGTAACTAACCCTTCATACTTGTTAATTGGAATATTATCATAAATT
TTGATAATGTTCGTGAATATTATCATAAGGGGTAATATTC