Description :
From Genome Similarity Track
Location :
contig_43:72102- 73295
Transcript NameFunction/comments
g6318.t1hypothetical protein
g6319.t1hypothetical protein PHYSODRAFT_384750

Sequence
1193 bases(100 bases per row)
CTTCCGGTTCGCCTTGCTCTCCACGTACGTCCGGAGCGGCCATTGTATCTTCAGACCTTCGAATCGGGGCGAGAGAAACATTTTCAATCGGGTGCTCTTT
CACCACGGGCAGCCCACGTTTTGGGCTGGCCGTGCCTCGTTTCGATGCAACAGGGTCGGGTACGAGCGTTGTCTTGCTCTTCTGAGCGCGACCCTCTTCG
AGGAATTGTCCAGCGAGGATCTCCAGCTTGGCCATGCACTTGCCGACGTAAAACTCGATGGCGAGGCATACAACGCTGGCCTCGGTTGTTCGGAAGAGAT
AGTCTTGGATAATCGCGTCGCCGCTACCAGCGCGTGGCGAGCCTGGAGAGGCTGGCGGAGGACTTCTACACCGCAGCAAGCAACAAGTGTAGCCCTGCTG
GAATACGACCGACCATTTCTCCAGATCTGTGTAGTACCAGGTGCTCAGCACGACATCCGCCTCGTGGCCCGTGCAAAAGGAAACTCCGTGGGATGAAATC
TCAAGCGAAGTGGCTTCAGTCGGGGATGTCTGCCCAGTCATCGCCAGCTTCACAGGGAAGCGGAGAACTTTGTCCGGGGCAATGGTTGCGTGCTTCTCAA
CGCACTCGGTTAGCACGTGGAGCCACACCTCGTACTCCGCTGGCTCCAGAGCCGCAAACGTCCACGTCCGGTACAACGTCACCACGTCAAACGAGTGCAT
CACCGGTGTACTAGCGTTGCTGTTGCGACCGACAGGACTGGCTGCAGACACGGGGCGAATGCACAGCACGGAGCTCAATCGATCACTCGCCGTTCCTTTG
GGGCGTCTGTCATGCCTGGACAGTGAGCGATCTTGTCGTAGTAGCACAGAATCCCCCACCGGAGTCTCAAACAGCACGACGAGCTTCGGGTGCCAAGCCT
TCCGCAGGTGGAAGGTGCGCGCATTCTGTCGCTTCTGCAGTTGTCCTTGAAACTTGAACATCTTAGCATAGTGCACCGACTGGAGCAGAGACGTCAACGG
CTGCATACTCTTGGCTGGGAGCGGAGGCTTGTCACGAGACAAGGTGGGCTTCTGCCTGGTTAGTAGCTCACTCGGCGTCGACGACAAGCAGGAGGCGTGG
AATTCACACAGGCCGCTCGTAAGAACTCGAGAGGTGCTTGGGTTTGTGCGCAGACTGCTGGGCTCTCTGGCATTAATGTGAACCATCACATTC