Description :
From Genome Similarity Track
Location :
Scaffold_536:721- 7014
Transcript NameFunction/comments
g14585.t1hypothetical protein

Sequence
6293 bases(100 bases per row)
GAAAAGGAGGTCGCAGATGCAATCAGTAAGTGCAAGAGCGGCAAAGCGTGCGGCCCGACGAGCTTGGCAACGAATGGTACAAAGACCACAAGGAGGAGTT
GGTGCCACTATTGACACGGATTTTCAACGACTGTATGGACCACGGTACTACGCCGGCGTCATTCTTGGAAGCTTTTATATTCAGCATCAGCAAGGAGGGG
GGGGGGACGGAGTCACCCGCTCAACTACCGCCCCATTGCCCTGCTCAACACGGACTATAAGCTTTTTACGCGAATACTGGCATAGCGAGTCCGGAAATAC
ATAACCAAGTTGGTGCATGAGAAGCAATACGGTTTTATCCCAGGACGTACCATACATGAAGCGATAGACCTCTTCGAAGCGACCAAGGAACTATGTCGAA
CGGGAGGGGACATGAATCACCTCAGTGAAGCACAGGTATTAATGCTGGACTTCGCGAAAGCGTACGATTCGCTCGATCACACCTTCCTCCTTGAAGTACT
CAGACGGAAAGGTTTCCCACCGCGGTTTTGTGCGATAGTGGAAGCCATTCACAGAGGAACAACAGTTCGCTTCATGGCCAACGGAGACCTCTCCAGGCCG
GTAATGGTAACCAGCGGGATACGGCAAGGGTGCCCGCTGGCACCGTTGCTGTTTGTAATTGCTGTGGACCTATTGTATACGGAGATCGAACAAGCACCAG
AGCTACAAGGAATACCCATGGGTAAGGACGAGCGAGCGAGCAACCTGATCGTGGCAGGATACGCTGACGATACAGCGATATACTTACAGCACCGTAGAAT
GCAAAAGGCCGCCATCCAAGCGGTTGGCAGGTTTTCAGCGGTGTCCGGACTAAAGCTCAACGTTGCAAAGTCATCAGCGATAGTTTTAGGGCCCGGCGGC
GAACAACAGCAGGACATCCACACGGAGGCCAACGAGGCGGCGGACGACAAAAAAGAAGAGGATCGGGAGCAAGAAGTGGCAGTAACGGAGGAAGTCAGGT
ACCTAGGGCACATCGCGGGGCCGAGAGACACCACGGAAGTGGCTTGGAAGAAGGCATACGGAACGTTAACCGTGCGGCTGGCGTTAGCGGAGCTTAAGAC
CAACACGGTGGCTCAACGGGCACTGATCGCCGCTGCGGTCATCGTGCCAAAGCTACTCTATGTGGCACGAAATGCGTGGCCCACGGACGACATCATCAAG
GTGGCAGACTTAAGAATACGAAACTTCGTGTGGCACGCATCTTTTGCAGCCCCGGAGAGTGCACCCATAGGGTGGGTCAAGCGAGAGCTAGCCGAACAGC
CCACGAGTAATGGCGGAGTGGGTATACCCAGCATTCAGACAGAGTTGCTAGCGATGAGCGCGACGATGGTCGGAAAGTGGGGCTTATCGCAGAACCCGCA
GATTCAATGAGTGGGGGAGATCTTGCAATCACGAGCAGCAGTAGAGGCAAAGCATCTGGAGTCGTCCACCAACAGACCCACAGGCAACATCGGGAAGTTG
AGCTGGGTAACAGGACGGAAATGGGCAGAACTATGGATGGCGCAACAAGCACCAGCAGTGGAGGACATCAGGGCCGAGGCCAAAAATATCAGACCGATGA
TGCGGGCCCGACACGGTTTAACGACAAAGTGGACCAAAACGGGTCTGGAGGTACGCTGCGTAGGCCAGCCGCGGGCCAAGATGTCAGTCATAGCCGCGGA
GCGAGCAAAAACACACGGCGACTTTATTTTGCGAGGCGGCCGACACGATCCAACTGGCTAAGTTGGGGTTATGGAATGATGCGGGCGGCCAGACAAAGTG
GAGCGACTACAAGGCAGTGGCGAAGGTCACGCAGTGCACAAGGTTACGGGATATAGCACAAGTGCTGAGAACACCAACCGGGGCGACGATAGTTGTCCCG
AAGGTGCCGGTCTTGGTGGGGACGGGGGAGGAGGAGGCTTTGTTTCGAGAAGTCGTGCTTAACGTCTTAGCGAGCTATCCTGAAATAGTGACTGGAAGAG
ACGAAACCGCGAGAGTGAGGGTACATCATTCCCTCGAGGACCCACATCACACTTTTGAGTTGGAGTCAGAGCAAGAAAGGCGATTCAGGCATTCATGGGC
CTTCACGTCTACGTGTGTGGATCTGAAGGATGGACGCGTGGCAGTGGAGAGAGCGGCAGCGGACATTTTGGCGATCAAGCGCAACGAGGTGTGGGTAGTA
CCGCACCCATGGATCACGAAGTCTAGGCCACTTTGGGCGGGCAAGAGGCGCTGGACGCAGAAGAGGAAGCATTACAAGCAATTAATTAACGAAGCCAGAG
ATATGAAGGCCGAGACAGCAAAGCAGGGTATACAAGACAAGTGGCGTCGTGGACATCCAAATTTGGCGGCGGCTATACAGAGATTGGAGTGGAAACGAAT
CGGAAGAATGTAGGGTGTAACTCCATATCAAGCCCAAAACATCAGGCGGCTCAAGGCACACAGGCTGCGGCTATGGACGGGGAAAGAGAATGGGTACAAG
TGTATGGGGGCTCAGTGCACACGGAGCACGGCGGAAGATTCAGGGCACCTGGCGTGGGAATGTGGAGATGCGCAGCATCACTGGAGAGCATGGCTAGATA
AGTGGGACCGTAGTGGGCTGCCAGCAGCGTCCGAACAGGACATCAGTGCAGAGGAGCGGGGAGACATCTTCGCTTTCCATATACGAAATGTACCGCAATG
GCTACGGGATTTGGGGCAGCAAACCAAAGTGGACACATGGGAGTTGCTACATCACGTGGCAGGAGAATTATGGACAATCGGATGTGCAGTGATACTCACT
GCCATATGGAGATGGAACGTCGACAGGCTATACGGCGCCGCGAAGCAGACCAAAAAGATAGAAGAGCAGGTGCCACGGGCGCTAAGCATGGTCACGGACG
CTTTCGAGAGGTACAGATTGGGCTTATACCCGGTCACACAAAGATCGCAACCAAAAATTGAGGTTGCGGCCGCAATTATACAGCGGTGGAAGCGCGTTTT
TGACAAACGTACGCCCTGGCGGCAGGATCAGGTGGTGCGGATTGGCTTTTTCGACGGGGGGTCTCGCGGCAATCCCGGAGCAGGCGGCGGCGGCAGTGTC
ATTGTGCAGCTGGGAGAGACTAACGCAAGCCACAAGATCATCTGAGCGGCAGCCACAGCACTCGAAAGATCAGACACAACCAACAACATTGCCGAATTTA
TCGGACTGCACAGACTCCTGGTCCATGCAGTGGAGACAGAATGGATGGATTTGCATGTGGTGGGCGATAGTGCTCTCATCTTGGGAATGATGATGAGACG
ATAGCCGCCGAAATTGCACAAATGGCAGCACTGGTACAGAGTTACGAGACGGCTGGCAGATTTGTGCGGGGTCCGCAGCTGGAGCCATCACTATCGGAAG
CACAACCAGATGTCAGACTGGCTCGCACATTTTGCTATGGACGACAAAAGGAGTGCATTGTGGACGGAGCAAGTTAATGGAGAAAGAGAGGCCATGTACG
GCGGAGTAAGGCAATTCCTGGCGACCGACCTCCAAAGATGGACGAAGGGGACAGAGATGCCAGCAGCGGGGAGGTAAACAGGAGCCTCGAGAAAATGACG
AAGGTGGAGACGAAGGTAGAGAACGAGTGAAGACAGCAGGGCAACAGGAGGCTGCCGGCAAAACTTGGTTGGATATGTAAGCCAACCAGGAATGGATATT
AGAGTTGGGGCCGCCAGGTACCAGTAACACAATATACCTTACCATTTAATAATAATACTTCTACAAGGCCGTGTCGCGGGTGTCTGTTTGTCTGGGTGCA
GCTCCCGCCCTGAAGATCAATAAATCTCGCATGACCTTCCTGGTCGGGTCGAACGCCACGGGATCGGAGAAGCTGCGGCTGTTGGTGTTGGACAAGTCCA
AAACGCCACGCTGGTTGCCGGAGAAGCCGAACAGCATGGACTACATCGGCACCAGCAAAGGCTGGATGACCACACTCGTGTTCAATGAGTGACTGGTGAA
GCGGAACAAGAAGATGAAGGCCGCTGACAGGAAGATCTTGCACGATAATGAGCCTGTGAACAAGGAACCTGAGGAGGCACTCTCGCATGTAGAGATCGCC
AGGCTGCCGAAGAACACCACGGCCATGCTGCAACGTATGGACCAGGGTGTCATTGCGTGGATCAAGGCAACGATTTTGAACGATATATCAGTGCGCTGCT
TTACTGATGGTTCTGTGCGTTGAGGAGGTTGCATATGCTATCGATACAGCAGACGCAATACAATGGCTGAGAGACGCGTGGAACGCAATGCCCAAAAAGG
TGCTTGCGAACTGCTGGAGACATACAGGTCTGCTCTCAGATCGACTAATGCGTGTGGACCACAATGTCAATGAAATCAATACTGTGACATCTTGCGCAAG
GGCGGTTGTCCTATCACAACGCGAGCTCCGTCTAAAATGATATTATCTAGCTCCCCAAGACACCCATCACTGTATTCATTTTACTTTGAAGATTCCCTCA
CCTTACCTGTCTTAAGATGAAAAAAATGAGGATATTACCTCATTTAATGAAGTCTGGTTATTTCGTATGGGTGTAGTTGGACAGCGAGTCAACGGCTCAG
GAACGGCCTGGACGAGCAGCGGCTGGTGGAGACGGTTACGATTGACTTGACGAGTGACTAGTGGGCGAAGGAACGGTGACGGAAAATGGCGACGAGGGCG
AGTCGGTGGCAGCGGCAAGACTGTAGGCTCCGGGCACCGATTGCCCGAGGTATCGGGTAGCTTGAAGTTGCTGAATGGCGACGATAGAAGATCGCGAGGA
GGGCGACATGGGACGAATATCGACGGAGTAGTATGGACGGCGGCGAGACGACGGCGAGATGAGTGGCGTGCGGCCAGGAGGCCAGGGGACAGCACCCGAA
TTGAGCAACGATAGAAAGAGGGGACAGCTCTATAGTTAGATCTAGTCTAGAGACTTCGAGGATATGAGGGGCACCGAGGGCGCGGTCTGCGGCTCGACCC
GCAGTCAAGATTTGGCAGCGAAGTGCTAAGTTGAGACTAACACGAGTAGTAAGCGACAGACGAGGTTGCTGGTCTGAAGACGAAGCCAGACCGACGCAAA
GCACGTAAGGTAAGCTGAGTAGCCAGGGAGAGTACGGGGACGGCTGAGTCAGTAGGCTGAAGAGGACCGCGGAGAAAGACCGTGGGGGCTGCGGTGCCTA
TTGATGGCGCCTTGGCCGAGGGGCGCATGCGCGAAGGCACCGCGCAGTCTAGTGACTCGCGCGGGGCGTCGTCCATGTGTCCGTTGCACATTTCATACGG
GATTGGCGGAGAGCAAACCGTGGTTTTCCCGAACCGCGGTCGCCAAACCGCTCTCTCCTCGACGTTCCTACCCCAAGATACCTCAAGGGTTGAGGGCCAG
ATTAGGCTGGTGACAACGCTCAGCCTCGCTCCTGGACAGTTACCCAGTGTTTCGTAGCGTCTGTAGGCTGAACCTCGTGAATTGACAGTGAAAGTTTGTC
GAACCTAACCGGGGAGATAACTACATGGGTACCGCATACACCTATTGGGGGGGGGTCGAACTTGGAAAAGGCCTCCAAAACTATGAGCAAGAAATCCTTG
CCGAAATAAGCAGGAAATGCTTGCGGGTATTCGAGGGCAACAGGAGGGAATCGCACTAATCTGTGAGGAGGTAGAAGCCGAACCTACTTATCCGTAATTT
TCCGGTAGCAAAACGCGATTGAGCTAGACAAGAAGTTCTGGAGTGCTGTGGAAGGCTATCGAGCAATTGGAAGTTCCCCGTTGATCCCGTTAGATGTTGC
CACCATTGCCCAACGGCGACAAGATGCGGCTAAATCCATTTACGAACAATTCTTCCGTGGTCAAAGAGCGGCCGCTCGCTTTGGAGACTATCGTGGAGTG
GCATTGGCGTGGTTGGAAATGTAGCCTAAGGAGGTGACGGATGCGAATCGGCAGCTCTCGATGGCCCCTAAAAACCTTTTTGGTGAGCTCCAGTGCACGG
TAGAGCTCCAACTCTCAGCAGCTCTCGCTAAACAGCATACAGATGAAGCACTTGGCTAGGAGAAGTATCGGAGACTTTTTACCACATTGACGGCCTTTTA
TTGACTCCAGTGGGCACTGCCACGAGCAGCGCTCGCTTCTGACTGTAGTTAATTGATAACCTGACAATCGATTTCGAGAACGGTGAAAAGTACTAGGACA
AGTCGGTGGCGAGAGGACGCTGATAACTGACGGGTATAACCGCACAAGAAAAGATAATGAGGACATTTCTTTGGTTGTTGTACCATTTTCAGG