Description :
From Genome Similarity Track
Location :
Scaffold_442:721- 3222
Sequence
2501 bases(100 bases per row)
ACAGCAGTGAGCACTTCATGCGGTATGCTTCGGGAGGGGCTAGTAATGCCACAAGGGCTGAGTAATGACCCTACTACGTTCAATAGATCTGTTACGAATC
TGTTGAGATCAGTGCGAGAGTTTGCAACCAGCTTTTTCGATGTTGTGTTCGTCCATAGCCGGGCTATGGATGGACGGACGGATTTGGAAGTCCACTGACT
CCATGTCCGAATAGTTCTTACACTGATACGTGAGCACAAGTTGTATACCAACCTCATGTAGTGCGTATTTGCTGCTAGCGAAATACCACTTCTAGGATGC
ATCGTGGGTAAGTACGGCGTCCGGCCCGATCCGGAAAAGATCAAGGCAATCACTGACTGGCCGGTGCCTACCAACGTAAAAGGACTTCGAAAGTCCTTGG
CCAAGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCACTCGTTTATTGGAAAAATAATGAGAAGTGGGCATGGAGTGC
TGATTGCCAGCGCTTCCTTCGAAGGTATCAAGCAAAGCTTGATACGCTCGCCATTTTTGGCAATTGCTGACCAAGACAGACCATTTCATGTGGTCTGCTA
TGCAAGTTATTTTGCCATCGGATGTGCACTGATGCAGTGTGACGCAGACGGTGCTGAGAGTGTCGTCTGCTATCAGTCACGTCAGCTGCAACCGGCAGAA
GTAACTACCCAGTCCATGACAAGGAACTCCTTGCCGTGAAGTATGCTTTGGCGAAGTTCAGGGTCTACCTACTAGGTGATAGACCCTTCATCGTATACAC
GGACCATGCGTCCTTACGCACGGCCGTTAACAGTCCACACCTCTCGCAACGAATGGCGAGATGGTTGTCGTTCTTCGCGGAGTATACCTTCTCCGTGGAA
TATAAACCAGGACGACTGAATGTCGTCGCTGATGCGCTGTCGCGCCGGCCCGATTTCGAACCGGCTACGCAACCCGACACTGGTCCGACCGCTGTCACGG
TGTTGACGTCGAGTGTCCCGTCGTCAACCTTATTCGAAAACATACGCAAGGCGTACGATCCGGCGATGGTGTGTTTGATGGAACATCTCTCGCAACCATC
CCTTCAATCCCTTAAACGTTTGCCCCAGTATATCGATCCTCCACGGATAGATATACAGTCCACAATGGCTTGCTGCAGTATACAGCCGTTGCCGGCGACA
CGCCTCGTGTCGTCGTACCGGGCGATGGTAACCTGCGACTGCGCATCATGTATGAGTACCACTATGCACCTACTGGTGGACATCGTGGTCGAGAGAAGAC
ATATCTCACAGTTAGTCGCGACTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGAAAGTGCGTCCGCGCATGCGAAGTATGTCAACGAGTGAAGTCAGGT
CCTTCACTTCGTGCGCCATTGCAACCCTTGCCCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTTAAATTCCCCGCAGACCCACACA
AGAATACAGGTATTCTTGTGTTCGTTGACAGATTCAGTAAAATGATACACCTGGTCGCTGTACCTGAATCTATCAATGCATCGGCGTGTGCTCGTATTTT
TATTGACACGATCTTTCGTATTCATGGGTTGCCTCGTGGACTCATTTTTGATCGAGACCCACGGTTCACTGCGAAATTCTGGCAATCCGTGTTCAAAACA
CTCGGAACGCGCCTTCAGATGTCTACCTCTGACCACTCTGAAACAGATGGTCAGATAGAACGTGCAAACCGCTTTCGTGAGGAAATCCTTTGGGGTTATG
TCCATTCGTTTACGAATTGGAGAGAATTCTTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCACCGACGACGCATACACCGTTCTTCGTGAA
TGGCTTGCGCCACCCACTCCTACCCACCTTCTTAGTGTAACTCTAGTTTGAGGGGGGAGGGAATCATTCGATCGAACGATAGTCGGCTCTCACTCATCAC
GTACTGACCACGAGGTCACTACGTATGAGGCCGATGTCGATCACATCGACTTCGATGAAGAAGAGGAAAGTAAGAGCGAGGATGCTCTTACTACCCAGGT
CACTGATCTTGCCACAGTGCGCTCCAAGTGCACTACAGCCAAAGACAGCGAGTCAGCAGATGAATTCATAGTGGCTCGCGAAACGATTGTCCGTTTCGTG
CAAGATTCCATTGCTGAAGCGTGGACCGACAAAAGAAAAACGTAGACAAGAATGGAAGAGCAAATGTTCTTTCATTCAATGAAGGTGACCTAGTCCCACT
ATCTACAGTAAACTTACCTCGACACATAGTGACTAACGTGGGTAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCGCATAGGC
AACGCATACACGATTAAACTGCCACGTAAGATGCGCGCGCATCCTACGTTCTACTTCGGTCGCCTTAGACCTTATCACCAGTACGGGACTTCTTCCGGTG
A