Description :
From Genome Similarity Track
Location :
Scaffold_1308:721- 2218
Transcript NameFunction/comments
Phyta_totarag12685hypothetical protein

Sequence
1497 bases(100 bases per row)
TTGTATTGTCGCGAGTCGTCCCGAAAGGGGAGGGACAGTCTACACCATATAGAAATAGGAGCTAAAGATTGAGAACACTTAAACAACAAGTCAAATAAAA
AGGATattcaacttgctgtcttCCGGGAAAATACACGACTGACCACTCCTAAACTACCAAACCTTACGACCTCTTCtcgcttctccgtcgctcCCTCCTT
CATAGGACCTCCCATCTTCGCAGGTATTCGTACGCCAGTACCTCGGTCAGCACGGCACACCCCTTCTCCTGGCAACAGCACTTGCGACCAGACCGTCCGT
CGGCGCCATCCGTCCTGCTTCTCGCTTCGTCCTAGCGCCGCCAAGTCGCGACTGGTCAGGCGTAGCGAAAGCCATGTCTGTTAACCCGGCCCGGGCCCAC
CCACGGGTCTTACTCTTAGCCAGCAACCTGATTTGGGCTGGGGCGCCTCGCCTGTCTCGCACGCGACCGGGCGTCCTGCTCATCCTCCCAGATCTGATCT
TCAACTCCTGTGAGGGGACGGTGATCACCGTGCCCGAGACGGTTGCCACCGTTCTCACTCGGGATATTCTCCCCGACTGcatctcggcgtcctcgtcgag
aCTCTCGGGCACGCATCTTGGTCTGCAGAGCTCTCTTTTCGGCTTGTAGTCCGCTGAGCGTGCGCACCGGCTCGCGCGTCGCCGGGTCACTACTTCCGTC
GGCACGCCAGAACGCATCGCTCAATCGTTTTgcctgttcctgctcctccatggcTTGCAGTCACGCACCGTAACCGTCTTCAGTCATCTTCAGCGGGGAC
CGCCCACCTGACGTCGCCTCAAGCCAGCGCCACAGGCGGCTGACTACGCCGACCACCATCACTAGACCGCTCACAGCGGCGACTTTCTTGTCGAACACGA
CACCGTCAACGACCTTCAACCCGTCTTCGCACATGAAATGGTAGTTCACCGCGCTCAACAGGACGAACACACCTGGCCCTCCTTGACTAGCCCATTCCAC
AATATCGTACAGGAACAACACTCCGTAGAAAACTGCATAGACCAGGAGAGACATAACCGTCCAGGTCGCGCGACCAGCAAAACATGCACGGTCAACCGTC
CTCAACTTCAATCCTTTCCAGTACTTCACGGTAGAACGCCAATCGTATTCCAGCGAATTTGGGAGAAACACACACCAAAAAGCGTGAAACGCATCAATCC
ACTTGTAGAGCAGACGCCCTAATCCTTCTAGGTGATCATGTCTtgtctccagcaccaccacgggCGTGGCCCACAAAGCGTCATAGCTCTTCCACCACCT
TTCGCCGCGGGGCGGACTCTGAAGAGCAGGTCTTCGAACGTACCGTCGGTACCGACGAATACACACTTTCGCCAGTCCGGTCCATTTGTATACGGCGTGA
CTTAATGCGGAGAACAGTCTAATCGCAACGGTACGGAGCGGTTGAGTGACCGTCCACACCAGTGCACCGGTCGTTAGCCACAGTAGTTCGCGCCAAT